Incidental Mutation 'R7450:Gna11'
ID577651
Institutional Source Beutler Lab
Gene Symbol Gna11
Ensembl Gene ENSMUSG00000034781
Gene Nameguanine nucleotide binding protein, alpha 11
SynonymsDsk7
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7450 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location81528724-81545190 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81532522 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 160 (Y160C)
Ref Sequence ENSEMBL: ENSMUSP00000043190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043604]
Predicted Effect
SMART Domains Protein: ENSMUSP00000043190
Gene: ENSMUSG00000034781
AA Change: Y160C

DomainStartEndE-ValueType
G_alpha 19 358 3.09e-208 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of guanine nucleotide-binding proteins (G proteins), which function as modulators or transducers in various transmembrane signaling systems. G proteins are composed of 3 units: alpha, beta and gamma. This gene encodes one of the alpha subunits (subunit alpha-11). Mutations in this gene have been associated with hypocalciuric hypercalcemia type II (HHC2) and hypocalcemia dominant 2 (HYPOC2). Patients with HHC2 and HYPOC2 exhibit decreased or increased sensitivity, respectively, to changes in extracellular calcium concentrations. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice deficient for this gene do not exhibit any detectable abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T A 5: 113,184,111 R746W possibly damaging Het
Abcc2 T C 19: 43,822,039 L925P probably damaging Het
Abcc3 A T 11: 94,361,695 H787Q probably damaging Het
Acly A T 11: 100,479,275 V987E probably damaging Het
Cacna1b A T 2: 24,635,135 Y1676* probably null Het
Ccdc175 T A 12: 72,155,673 I283F possibly damaging Het
Cfap46 A T 7: 139,617,437 F2173I unknown Het
Cln6 G A 9: 62,850,630 E224K probably damaging Het
Cyp1a1 T A 9: 57,702,132 L372Q probably damaging Het
Dirc2 T C 16: 35,768,974 I90V possibly damaging Het
Dnah8 T A 17: 30,787,191 I3694N probably damaging Het
Dnal1 T C 12: 84,124,523 Y31H probably benign Het
Eid3 T A 10: 82,866,903 M66K probably benign Het
Epo T A 5: 137,483,235 E143D probably damaging Het
Fbxo25 C A 8: 13,931,235 N236K probably benign Het
Fsip2 A G 2: 82,951,680 I266V probably benign Het
Galnt6 T C 15: 100,697,815 Y444C probably damaging Het
Gm14139 A G 2: 150,193,126 T456A probably benign Het
Gm8251 A G 1: 44,058,773 V1055A probably benign Het
Hectd4 A T 5: 121,281,932 T647S probably benign Het
Hgd T C 16: 37,624,324 V316A possibly damaging Het
Idh3a T C 9: 54,596,083 V142A probably damaging Het
Il3ra T A 14: 14,351,090 I297N probably benign Het
Kcnj5 T G 9: 32,322,195 I275L possibly damaging Het
Kdm7a A T 6: 39,143,251 L928Q probably damaging Het
Kmo A G 1: 175,639,100 I75V probably benign Het
Krtap1-3 C A 11: 99,590,871 C150F unknown Het
Lingo3 C A 10: 80,834,837 E420* probably null Het
Lrrc37a A G 11: 103,498,326 V2091A probably benign Het
N4bp2 T A 5: 65,825,300 Y1632* probably null Het
Nlrp1a C A 11: 71,107,658 G905V probably damaging Het
Nlrp9c T A 7: 26,364,939 E988V probably benign Het
Nol8 T G 13: 49,660,015 H179Q probably benign Het
Notch3 G A 17: 32,141,391 P1522L possibly damaging Het
Nup210l T C 3: 90,115,188 probably null Het
Oas1b T A 5: 120,821,256 Y234* probably null Het
Olfr109 C A 17: 37,466,616 Q137K probably benign Het
Olfr1150-ps1 A C 2: 87,846,459 K63Q probably damaging Het
Olfr129 T C 17: 38,055,109 I152M probably benign Het
Olfr271-ps1 T A 4: 52,936,113 K57* probably null Het
Olfr786 A C 10: 129,437,429 M206L probably benign Het
Pag1 T C 3: 9,699,539 T185A probably damaging Het
Palmd A T 3: 116,927,643 S100T probably damaging Het
Papln C A 12: 83,780,171 A690E probably benign Het
Pcdhga7 C T 18: 37,716,026 T362M probably benign Het
Pmpcb T A 5: 21,746,985 V286E possibly damaging Het
Pon3 T C 6: 5,236,940 I142M possibly damaging Het
Prdx6 A G 1: 161,241,816 S194P probably benign Het
Rapgef2 T C 3: 79,173,059 E112G probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rps6kb1 T A 11: 86,502,831 E491V probably benign Het
Sema3d C T 5: 12,584,934 Q656* probably null Het
Shisa6 A T 11: 66,218,006 D348E probably benign Het
Slc16a7 G T 10: 125,228,051 H472Q probably benign Het
Slc9a2 A G 1: 40,681,835 probably benign Het
Smad4 A G 18: 73,677,853 V20A probably damaging Het
Spata5 T C 3: 37,456,785 L697S probably damaging Het
Sstr3 G A 15: 78,539,843 R235W probably damaging Het
Svep1 T A 4: 58,064,248 H3245L possibly damaging Het
Tra2a G A 6: 49,250,985 R70* probably null Het
Trav7-4 G T 14: 53,461,467 V24L probably benign Het
Tsc2 C A 17: 24,600,031 S1278I probably damaging Het
Ubtf A G 11: 102,306,649 S726P unknown Het
Vmn2r42 A T 7: 8,184,221 Y851N probably benign Het
Wwp1 A G 4: 19,640,016 Y509H probably damaging Het
Xirp2 A C 2: 67,509,815 Q800P possibly damaging Het
Zc3h7b T C 15: 81,783,080 F609L probably benign Het
Zdhhc8 G T 16: 18,225,171 H388Q probably benign Het
Zfp644 T C 5: 106,638,526 K52E probably benign Het
Zfp82 T G 7: 30,056,895 E254A probably damaging Het
Other mutations in Gna11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Gna11 APN 10 81530884 missense probably damaging 1.00
IGL02972:Gna11 APN 10 81533391 missense probably benign
IGL03290:Gna11 APN 10 81530937 missense probably damaging 1.00
R0057:Gna11 UTSW 10 81530940 missense probably benign 0.19
R0057:Gna11 UTSW 10 81530940 missense probably benign 0.19
R0417:Gna11 UTSW 10 81530904 missense probably damaging 1.00
R1542:Gna11 UTSW 10 81533328 missense probably benign
R1957:Gna11 UTSW 10 81530844 missense probably damaging 1.00
R5180:Gna11 UTSW 10 81544873 missense probably benign 0.01
R5534:Gna11 UTSW 10 81531133 missense probably damaging 1.00
R5967:Gna11 UTSW 10 81530809 missense probably benign 0.11
R6445:Gna11 UTSW 10 81533333 missense probably damaging 1.00
R6523:Gna11 UTSW 10 81544854 missense probably damaging 1.00
R7556:Gna11 UTSW 10 81531374 missense
Predicted Primers PCR Primer
(F):5'- TCTAAACCTCAGGATCCCCG -3'
(R):5'- GAACAACTGTGACTCTAGATCAATGG -3'

Sequencing Primer
(F):5'- TTCCAGTCCCGGCCAAG -3'
(R):5'- CAATGGAGATAGTGTGCTCTCACC -3'
Posted On2019-10-07