Incidental Mutation 'R7450:Slc16a7'
ID 577653
Institutional Source Beutler Lab
Gene Symbol Slc16a7
Ensembl Gene ENSMUSG00000020102
Gene Name solute carrier family 16 (monocarboxylic acid transporters), member 7
Synonyms 4921534N07Rik, MCT2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7450 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 125219270-125389465 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 125228051 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 472 (H472Q)
Ref Sequence ENSEMBL: ENSMUSP00000065433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063318] [ENSMUST00000105257] [ENSMUST00000210780] [ENSMUST00000211781]
AlphaFold O70451
Predicted Effect probably benign
Transcript: ENSMUST00000063318
AA Change: H472Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000065433
Gene: ENSMUSG00000020102
AA Change: H472Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 2e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105257
AA Change: H472Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000100892
Gene: ENSMUSG00000020102
AA Change: H472Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:MFS_1 22 389 6e-37 PFAM
transmembrane domain 404 426 N/A INTRINSIC
coiled coil region 436 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210780
AA Change: H472Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000211781
AA Change: H472Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the monocarboxylate transporter family. Members in this family transport metabolites, such as lactate, pyruvate, and ketone bodies. The protein encoded by this gene catalyzes the proton-linked transport of monocarboxylates and has the highest affinity for pyruvate. This protein has been reported to be more highly expressed in prostate and colorectal cancer specimens when compared to control specimens. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T A 5: 113,184,111 R746W possibly damaging Het
Abcc2 T C 19: 43,822,039 L925P probably damaging Het
Abcc3 A T 11: 94,361,695 H787Q probably damaging Het
Acly A T 11: 100,479,275 V987E probably damaging Het
Cacna1b A T 2: 24,635,135 Y1676* probably null Het
Ccdc175 T A 12: 72,155,673 I283F possibly damaging Het
Cfap46 A T 7: 139,617,437 F2173I unknown Het
Cln6 G A 9: 62,850,630 E224K probably damaging Het
Cyp1a1 T A 9: 57,702,132 L372Q probably damaging Het
Dirc2 T C 16: 35,768,974 I90V possibly damaging Het
Dnah8 T A 17: 30,787,191 I3694N probably damaging Het
Dnal1 T C 12: 84,124,523 Y31H probably benign Het
Eid3 T A 10: 82,866,903 M66K probably benign Het
Epo T A 5: 137,483,235 E143D probably damaging Het
Fbxo25 C A 8: 13,931,235 N236K probably benign Het
Fsip2 A G 2: 82,951,680 I266V probably benign Het
Galnt6 T C 15: 100,697,815 Y444C probably damaging Het
Gm14139 A G 2: 150,193,126 T456A probably benign Het
Gm8251 A G 1: 44,058,773 V1055A probably benign Het
Gna11 T C 10: 81,532,522 Y160C Het
Hectd4 A T 5: 121,281,932 T647S probably benign Het
Hgd T C 16: 37,624,324 V316A possibly damaging Het
Idh3a T C 9: 54,596,083 V142A probably damaging Het
Il3ra T A 14: 14,351,090 I297N probably benign Het
Kcnj5 T G 9: 32,322,195 I275L possibly damaging Het
Kdm7a A T 6: 39,143,251 L928Q probably damaging Het
Kmo A G 1: 175,639,100 I75V probably benign Het
Krtap1-3 C A 11: 99,590,871 C150F unknown Het
Lingo3 C A 10: 80,834,837 E420* probably null Het
Lrrc37a A G 11: 103,498,326 V2091A probably benign Het
N4bp2 T A 5: 65,825,300 Y1632* probably null Het
Nlrp1a C A 11: 71,107,658 G905V probably damaging Het
Nlrp9c T A 7: 26,364,939 E988V probably benign Het
Nol8 T G 13: 49,660,015 H179Q probably benign Het
Notch3 G A 17: 32,141,391 P1522L possibly damaging Het
Nup210l T C 3: 90,115,188 probably null Het
Oas1b T A 5: 120,821,256 Y234* probably null Het
Olfr109 C A 17: 37,466,616 Q137K probably benign Het
Olfr1150-ps1 A C 2: 87,846,459 K63Q probably damaging Het
Olfr129 T C 17: 38,055,109 I152M probably benign Het
Olfr271-ps1 T A 4: 52,936,113 K57* probably null Het
Olfr786 A C 10: 129,437,429 M206L probably benign Het
Pag1 T C 3: 9,699,539 T185A probably damaging Het
Palmd A T 3: 116,927,643 S100T probably damaging Het
Papln C A 12: 83,780,171 A690E probably benign Het
Pcdhga7 C T 18: 37,716,026 T362M probably benign Het
Pmpcb T A 5: 21,746,985 V286E possibly damaging Het
Pon3 T C 6: 5,236,940 I142M possibly damaging Het
Prdx6 A G 1: 161,241,816 S194P probably benign Het
Rapgef2 T C 3: 79,173,059 E112G probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rps6kb1 T A 11: 86,502,831 E491V probably benign Het
Sema3d C T 5: 12,584,934 Q656* probably null Het
Shisa6 A T 11: 66,218,006 D348E probably benign Het
Slc9a2 A G 1: 40,681,835 probably benign Het
Smad4 A G 18: 73,677,853 V20A probably damaging Het
Spata5 T C 3: 37,456,785 L697S probably damaging Het
Sstr3 G A 15: 78,539,843 R235W probably damaging Het
Svep1 T A 4: 58,064,248 H3245L possibly damaging Het
Tra2a G A 6: 49,250,985 R70* probably null Het
Trav7-4 G T 14: 53,461,467 V24L probably benign Het
Tsc2 C A 17: 24,600,031 S1278I probably damaging Het
Ubtf A G 11: 102,306,649 S726P unknown Het
Vmn2r42 A T 7: 8,184,221 Y851N probably benign Het
Wwp1 A G 4: 19,640,016 Y509H probably damaging Het
Xirp2 A C 2: 67,509,815 Q800P possibly damaging Het
Zc3h7b T C 15: 81,783,080 F609L probably benign Het
Zdhhc8 G T 16: 18,225,171 H388Q probably benign Het
Zfp644 T C 5: 106,638,526 K52E probably benign Het
Zfp82 T G 7: 30,056,895 E254A probably damaging Het
Other mutations in Slc16a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00857:Slc16a7 APN 10 125230934 missense probably benign 0.16
IGL02228:Slc16a7 APN 10 125230798 missense probably damaging 1.00
IGL02500:Slc16a7 APN 10 125230933 missense probably damaging 1.00
IGL03277:Slc16a7 APN 10 125230691 missense probably benign 0.00
R0044:Slc16a7 UTSW 10 125228082 missense probably benign 0.01
R0076:Slc16a7 UTSW 10 125228070 missense probably benign 0.34
R0285:Slc16a7 UTSW 10 125294631 missense probably benign 0.22
R0546:Slc16a7 UTSW 10 125230873 missense probably benign 0.02
R0898:Slc16a7 UTSW 10 125233501 missense possibly damaging 0.46
R1123:Slc16a7 UTSW 10 125231147 missense probably benign 0.00
R1173:Slc16a7 UTSW 10 125231372 missense possibly damaging 0.82
R1459:Slc16a7 UTSW 10 125230620 nonsense probably null
R1554:Slc16a7 UTSW 10 125230922 missense possibly damaging 0.70
R1838:Slc16a7 UTSW 10 125231198 missense probably damaging 1.00
R3545:Slc16a7 UTSW 10 125294700 nonsense probably null
R3546:Slc16a7 UTSW 10 125294700 nonsense probably null
R3547:Slc16a7 UTSW 10 125294700 nonsense probably null
R3934:Slc16a7 UTSW 10 125230843 missense probably damaging 1.00
R3935:Slc16a7 UTSW 10 125230843 missense probably damaging 1.00
R4499:Slc16a7 UTSW 10 125228187 missense probably damaging 1.00
R4512:Slc16a7 UTSW 10 125233439 splice site probably null
R4513:Slc16a7 UTSW 10 125233439 splice site probably null
R4514:Slc16a7 UTSW 10 125233439 splice site probably null
R5157:Slc16a7 UTSW 10 125233464 nonsense probably null
R5247:Slc16a7 UTSW 10 125231314 missense probably damaging 1.00
R5385:Slc16a7 UTSW 10 125294604 missense possibly damaging 0.85
R6198:Slc16a7 UTSW 10 125228215 missense probably benign
R6263:Slc16a7 UTSW 10 125294639 missense probably benign 0.16
R6430:Slc16a7 UTSW 10 125231018 missense probably damaging 0.97
R7680:Slc16a7 UTSW 10 125230936 missense probably benign 0.19
R8125:Slc16a7 UTSW 10 125328333 critical splice donor site probably null
R9133:Slc16a7 UTSW 10 125230667 missense probably benign 0.00
R9301:Slc16a7 UTSW 10 125231011 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTATGGCATTGAGGAAGATGCC -3'
(R):5'- ATACCTGTACATAGCCAGCGG -3'

Sequencing Primer
(F):5'- CATTGAGGAAGATGCCAGTTTTG -3'
(R):5'- TGTACATAGCCAGCGGAACAGTC -3'
Posted On 2019-10-07