Incidental Mutation 'R0629:Oprm1'
ID 57766
Institutional Source Beutler Lab
Gene Symbol Oprm1
Ensembl Gene ENSMUSG00000000766
Gene Name opioid receptor, mu 1
Synonyms MOP-R, MOR-1, MOP receptor, mor, Oprm, muOR
MMRRC Submission 038818-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R0629 (G1)
Quality Score 188
Status Validated
Chromosome 10
Chromosomal Location 6708593-6988209 bp(+) (GRCm39)
Type of Mutation splice site (1965 bp from exon)
DNA Base Change (assembly) A to T at 6782604 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000783] [ENSMUST00000052751] [ENSMUST00000056385] [ENSMUST00000063036] [ENSMUST00000078634] [ENSMUST00000092729] [ENSMUST00000092731] [ENSMUST00000092734] [ENSMUST00000105597] [ENSMUST00000135502] [ENSMUST00000105611] [ENSMUST00000147171] [ENSMUST00000105607] [ENSMUST00000123861] [ENSMUST00000105615] [ENSMUST00000143875] [ENSMUST00000129954] [ENSMUST00000105605] [ENSMUST00000105602] [ENSMUST00000105603] [ENSMUST00000144264] [ENSMUST00000129221] [ENSMUST00000105601] [ENSMUST00000105604] [ENSMUST00000154906] [ENSMUST00000154941] [ENSMUST00000152674] [ENSMUST00000150374]
AlphaFold P42866
Predicted Effect probably benign
Transcript: ENSMUST00000000783
SMART Domains Protein: ENSMUSP00000000783
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 1.6e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.3e-10 PFAM
Pfam:7tm_1 85 336 4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052751
SMART Domains Protein: ENSMUSP00000060329
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056385
SMART Domains Protein: ENSMUSP00000060590
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063036
SMART Domains Protein: ENSMUSP00000053498
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 8.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078634
AA Change: N416Y

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000077704
Gene: ENSMUSG00000000766
AA Change: N416Y

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 2.4e-10 PFAM
Pfam:7tm_1 85 336 9e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092729
SMART Domains Protein: ENSMUSP00000090405
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.6e-11 PFAM
Pfam:7tm_1 85 336 3.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092731
SMART Domains Protein: ENSMUSP00000090407
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.9e-11 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092734
SMART Domains Protein: ENSMUSP00000090410
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105597
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141897
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148625
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133486
Predicted Effect probably benign
Transcript: ENSMUST00000135502
SMART Domains Protein: ENSMUSP00000135143
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 339 2.2e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.9e-10 PFAM
Pfam:7tm_1 85 336 7.5e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105611
SMART Domains Protein: ENSMUSP00000101236
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.4e-10 PFAM
Pfam:7tm_1 85 336 4.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147171
SMART Domains Protein: ENSMUSP00000117950
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 9.2e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105607
SMART Domains Protein: ENSMUSP00000101232
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.3e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123861
SMART Domains Protein: ENSMUSP00000120187
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105615
SMART Domains Protein: ENSMUSP00000101240
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7tm_1 24 268 1.3e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143875
Predicted Effect probably benign
Transcript: ENSMUST00000129954
SMART Domains Protein: ENSMUSP00000122385
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 338 6.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.5e-10 PFAM
Pfam:7tm_1 85 336 5.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105605
SMART Domains Protein: ENSMUSP00000101230
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.8e-11 PFAM
Pfam:7tm_1 85 336 3.2e-67 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000105602
SMART Domains Protein: ENSMUSP00000101227
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.8e-11 PFAM
Pfam:7tm_1 85 336 3.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105603
SMART Domains Protein: ENSMUSP00000101228
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 6.7e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.6e-11 PFAM
Pfam:7tm_1 85 336 3.6e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144264
SMART Domains Protein: ENSMUSP00000115836
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 325 1.7e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1e-10 PFAM
Pfam:7tm_1 85 336 3.4e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129221
SMART Domains Protein: ENSMUSP00000123117
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 1.1e-7 PFAM
Pfam:7TM_GPCR_Srsx 15 287 7.3e-11 PFAM
Pfam:7tm_1 21 272 2.4e-67 PFAM
low complexity region 340 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105601
SMART Domains Protein: ENSMUSP00000101226
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 100 3e-9 SMART
PDB:4DKL|A 52 100 3e-21 PDB
low complexity region 119 131 N/A INTRINSIC
low complexity region 173 184 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105604
SMART Domains Protein: ENSMUSP00000101229
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 332 5.1e-8 PFAM
Pfam:7TM_GPCR_Srsx 79 351 9.9e-11 PFAM
Pfam:7tm_1 85 336 3.8e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154906
SMART Domains Protein: ENSMUSP00000114342
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 76 332 1.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 79 351 1.1e-10 PFAM
Pfam:7tm_1 85 336 3.6e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154941
SMART Domains Protein: ENSMUSP00000115413
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 12 261 9.6e-8 PFAM
Pfam:7TM_GPCR_Srsx 15 287 6.1e-11 PFAM
Pfam:7tm_1 21 272 2e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152674
SMART Domains Protein: ENSMUSP00000115552
Gene: ENSMUSG00000000766

DomainStartEndE-ValueType
SCOP:d1l9ha_ 46 94 8e-8 SMART
PDB:4DKL|A 52 94 7e-23 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000150374
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes the mu opioid receptor which is where drugs such as morphine and other opioids have pharmacological effects. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygotes for null mutations exhibit isoform dependent loss of behavioral and gastrointestinal opioid responses and may also show impaired spatial memory, heightened nociception, reduced locomotor activity, increased hematopoietic proliferation, and decreased male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,818,473 (GRCm39) D86V probably damaging Het
Adamts14 G A 10: 61,047,403 (GRCm39) Q733* probably null Het
Adcy10 A G 1: 165,370,674 (GRCm39) D651G probably damaging Het
Apcdd1 T A 18: 63,067,041 (GRCm39) C52S probably damaging Het
Bclaf1 T C 10: 20,209,172 (GRCm39) S463P probably damaging Het
Cabcoco1 T C 10: 68,352,108 (GRCm39) Y68C probably damaging Het
Cacna1f G A X: 7,486,673 (GRCm39) S888N probably damaging Het
Cacna1g A G 11: 94,300,369 (GRCm39) C2134R possibly damaging Het
Cdc37 A C 9: 21,052,064 (GRCm39) M325R possibly damaging Het
Clca3a2 T A 3: 144,778,000 (GRCm39) M762L probably benign Het
Cntn3 C T 6: 102,180,937 (GRCm39) V753M probably damaging Het
Col6a6 A T 9: 105,604,364 (GRCm39) probably benign Het
Dscaml1 A G 9: 45,632,716 (GRCm39) D1194G probably damaging Het
Egfr G A 11: 16,819,333 (GRCm39) G288S probably damaging Het
Fbxl17 G T 17: 63,778,409 (GRCm39) N19K probably damaging Het
Fmo3 A G 1: 162,785,796 (GRCm39) probably benign Het
Frmd6 T C 12: 70,930,536 (GRCm39) Y219H probably damaging Het
Fuca1 T C 4: 135,652,955 (GRCm39) V193A possibly damaging Het
Gm7461 C T 8: 4,727,769 (GRCm39) noncoding transcript Het
Gpc5 T A 14: 115,789,651 (GRCm39) N508K possibly damaging Het
Iqch A T 9: 63,332,664 (GRCm39) D1019E probably benign Het
Isyna1 A G 8: 71,047,358 (GRCm39) Y27C probably damaging Het
Itgb8 T G 12: 119,166,216 (GRCm39) H105P probably benign Het
Kbtbd11 C T 8: 15,077,572 (GRCm39) P57L probably benign Het
Kcns3 A C 12: 11,142,559 (GRCm39) C47G probably damaging Het
Kif21b A T 1: 136,099,895 (GRCm39) probably null Het
Lama3 A T 18: 12,552,302 (GRCm39) H418L possibly damaging Het
Lrit3 A G 3: 129,581,951 (GRCm39) Y679H probably damaging Het
Lrrc19 T A 4: 94,526,489 (GRCm39) D356V probably damaging Het
Morc2b A G 17: 33,354,781 (GRCm39) M997T probably benign Het
Mroh9 T C 1: 162,888,205 (GRCm39) H290R possibly damaging Het
Mtcl1 A T 17: 66,645,137 (GRCm39) S1886T possibly damaging Het
Muc20 T C 16: 32,613,791 (GRCm39) T529A possibly damaging Het
Myo7a A C 7: 97,734,673 (GRCm39) L607R probably damaging Het
Myom2 T A 8: 15,119,783 (GRCm39) F180I probably damaging Het
Myt1l G A 12: 29,861,484 (GRCm39) E89K unknown Het
Nek2 A G 1: 191,563,429 (GRCm39) N431S probably benign Het
Or2aj4 A T 16: 19,384,730 (GRCm39) V301E possibly damaging Het
Or5t7 T A 2: 86,506,873 (GRCm39) H268L possibly damaging Het
Oxsr1 A G 9: 119,070,850 (GRCm39) probably benign Het
Pasd1 G C X: 70,982,379 (GRCm39) R296P possibly damaging Het
Pdgfrb G A 18: 61,211,720 (GRCm39) probably null Het
Proser1 C A 3: 53,386,485 (GRCm39) P789Q probably benign Het
Ptgs2 A G 1: 149,976,788 (GRCm39) Q7R probably benign Het
Rab3d A G 9: 21,825,982 (GRCm39) V144A probably benign Het
Ralgapb T A 2: 158,281,467 (GRCm39) L167H probably damaging Het
Ranbp3 A G 17: 57,015,200 (GRCm39) T301A possibly damaging Het
Rasgrf1 G A 9: 89,866,322 (GRCm39) V587M probably damaging Het
Sec16b A G 1: 157,392,433 (GRCm39) probably benign Het
Sin3b T C 8: 73,480,164 (GRCm39) probably benign Het
Slc10a2 T C 8: 5,148,562 (GRCm39) S128G probably benign Het
Tbl1xr1 G A 3: 22,264,565 (GRCm39) V507I probably benign Het
Tmem8b T G 4: 43,669,896 (GRCm39) probably null Het
Trak1 A T 9: 121,196,233 (GRCm39) T22S probably benign Het
Trim30d A G 7: 104,136,862 (GRCm39) I114T probably damaging Het
Ttc13 A T 8: 125,401,105 (GRCm39) S624T probably damaging Het
Ttn T C 2: 76,658,474 (GRCm39) probably benign Het
Vipr1 T A 9: 121,489,237 (GRCm39) Y99* probably null Het
Vmn1r210 T C 13: 23,012,044 (GRCm39) K81E probably damaging Het
Wwc1 T C 11: 35,744,299 (GRCm39) Y841C probably benign Het
Xrcc4 A G 13: 90,149,024 (GRCm39) probably benign Het
Zdhhc22 A T 12: 87,035,071 (GRCm39) I127N probably damaging Het
Zdhhc7 A G 8: 120,814,785 (GRCm39) L8P possibly damaging Het
Zfp664 C A 5: 124,962,659 (GRCm39) L18I probably damaging Het
Other mutations in Oprm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Oprm1 APN 10 6,987,170 (GRCm39) utr 3 prime probably benign
IGL01768:Oprm1 APN 10 6,779,186 (GRCm39) missense probably damaging 1.00
IGL02455:Oprm1 APN 10 6,780,219 (GRCm39) missense probably damaging 1.00
IGL03391:Oprm1 APN 10 6,964,077 (GRCm39) intron probably benign
IGL03410:Oprm1 APN 10 6,780,051 (GRCm39) missense probably damaging 1.00
IGL03048:Oprm1 UTSW 10 6,779,064 (GRCm39) missense probably damaging 1.00
R0189:Oprm1 UTSW 10 6,739,071 (GRCm39) missense possibly damaging 0.94
R0321:Oprm1 UTSW 10 6,779,183 (GRCm39) missense probably damaging 1.00
R0730:Oprm1 UTSW 10 6,782,652 (GRCm39) intron probably benign
R1542:Oprm1 UTSW 10 6,738,960 (GRCm39) missense probably damaging 1.00
R1743:Oprm1 UTSW 10 6,780,105 (GRCm39) missense probably damaging 0.99
R1874:Oprm1 UTSW 10 6,739,035 (GRCm39) missense probably benign 0.17
R2864:Oprm1 UTSW 10 6,744,226 (GRCm39) splice site probably null
R2964:Oprm1 UTSW 10 6,738,914 (GRCm39) missense probably damaging 0.98
R3792:Oprm1 UTSW 10 6,789,544 (GRCm39) missense probably benign 0.00
R4008:Oprm1 UTSW 10 6,782,520 (GRCm39) missense probably benign
R4049:Oprm1 UTSW 10 6,779,087 (GRCm39) missense probably benign 0.36
R4088:Oprm1 UTSW 10 6,780,234 (GRCm39) missense probably damaging 1.00
R4724:Oprm1 UTSW 10 6,708,656 (GRCm39) nonsense probably null
R4812:Oprm1 UTSW 10 6,782,698 (GRCm39) intron probably benign
R4822:Oprm1 UTSW 10 6,779,036 (GRCm39) missense probably damaging 0.99
R4855:Oprm1 UTSW 10 6,788,468 (GRCm39) missense probably benign 0.01
R5072:Oprm1 UTSW 10 6,782,550 (GRCm39) missense probably benign 0.15
R5768:Oprm1 UTSW 10 6,739,026 (GRCm39) missense probably damaging 1.00
R5770:Oprm1 UTSW 10 6,739,026 (GRCm39) missense probably damaging 1.00
R5995:Oprm1 UTSW 10 6,782,520 (GRCm39) missense probably benign
R6327:Oprm1 UTSW 10 6,780,063 (GRCm39) missense probably damaging 0.99
R7135:Oprm1 UTSW 10 6,780,203 (GRCm39) missense possibly damaging 0.77
R7413:Oprm1 UTSW 10 6,778,919 (GRCm39) missense probably damaging 1.00
R7455:Oprm1 UTSW 10 6,780,204 (GRCm39) missense probably damaging 1.00
R8192:Oprm1 UTSW 10 6,788,417 (GRCm39) missense probably benign 0.04
R8210:Oprm1 UTSW 10 6,780,442 (GRCm39) missense probably benign 0.02
R8945:Oprm1 UTSW 10 6,782,644 (GRCm39) intron probably benign
R9054:Oprm1 UTSW 10 6,773,914 (GRCm39) intron probably benign
R9723:Oprm1 UTSW 10 6,788,514 (GRCm39) missense possibly damaging 0.66
R9726:Oprm1 UTSW 10 6,929,694 (GRCm39) missense probably benign 0.00
X0066:Oprm1 UTSW 10 6,780,462 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGCTTTCAAACTCTTGCCCATCAC -3'
(R):5'- TTATCTGATGCTGACGCTGCTCCG -3'

Sequencing Primer
(F):5'- CTTGCCCATCACTTTGAAAGAG -3'
(R):5'- AGTTACTTAGGACAGAGCTTCTCC -3'
Posted On 2013-07-11