Incidental Mutation 'R7450:Ccdc175'
ID577663
Institutional Source Beutler Lab
Gene Symbol Ccdc175
Ensembl Gene ENSMUSG00000021086
Gene Namecoiled-coil domain containing 175
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R7450 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location72101300-72185029 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72155673 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 283 (I283F)
Ref Sequence ENSEMBL: ENSMUSP00000021494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021494]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021494
AA Change: I283F

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021494
Gene: ENSMUSG00000021086
AA Change: I283F

DomainStartEndE-ValueType
coiled coil region 129 164 N/A INTRINSIC
coiled coil region 205 235 N/A INTRINSIC
coiled coil region 295 383 N/A INTRINSIC
low complexity region 470 490 N/A INTRINSIC
coiled coil region 517 537 N/A INTRINSIC
low complexity region 803 819 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T A 5: 113,184,111 R746W possibly damaging Het
Abcc2 T C 19: 43,822,039 L925P probably damaging Het
Abcc3 A T 11: 94,361,695 H787Q probably damaging Het
Acly A T 11: 100,479,275 V987E probably damaging Het
Cacna1b A T 2: 24,635,135 Y1676* probably null Het
Cfap46 A T 7: 139,617,437 F2173I unknown Het
Cln6 G A 9: 62,850,630 E224K probably damaging Het
Cyp1a1 T A 9: 57,702,132 L372Q probably damaging Het
Dirc2 T C 16: 35,768,974 I90V possibly damaging Het
Dnah8 T A 17: 30,787,191 I3694N probably damaging Het
Dnal1 T C 12: 84,124,523 Y31H probably benign Het
Eid3 T A 10: 82,866,903 M66K probably benign Het
Epo T A 5: 137,483,235 E143D probably damaging Het
Fbxo25 C A 8: 13,931,235 N236K probably benign Het
Fsip2 A G 2: 82,951,680 I266V probably benign Het
Galnt6 T C 15: 100,697,815 Y444C probably damaging Het
Gm14139 A G 2: 150,193,126 T456A probably benign Het
Gm8251 A G 1: 44,058,773 V1055A probably benign Het
Gna11 T C 10: 81,532,522 Y160C Het
Hectd4 A T 5: 121,281,932 T647S probably benign Het
Hgd T C 16: 37,624,324 V316A possibly damaging Het
Idh3a T C 9: 54,596,083 V142A probably damaging Het
Il3ra T A 14: 14,351,090 I297N probably benign Het
Kcnj5 T G 9: 32,322,195 I275L possibly damaging Het
Kdm7a A T 6: 39,143,251 L928Q probably damaging Het
Kmo A G 1: 175,639,100 I75V probably benign Het
Krtap1-3 C A 11: 99,590,871 C150F unknown Het
Lingo3 C A 10: 80,834,837 E420* probably null Het
Lrrc37a A G 11: 103,498,326 V2091A probably benign Het
N4bp2 T A 5: 65,825,300 Y1632* probably null Het
Nlrp1a C A 11: 71,107,658 G905V probably damaging Het
Nlrp9c T A 7: 26,364,939 E988V probably benign Het
Nol8 T G 13: 49,660,015 H179Q probably benign Het
Notch3 G A 17: 32,141,391 P1522L possibly damaging Het
Nup210l T C 3: 90,115,188 probably null Het
Oas1b T A 5: 120,821,256 Y234* probably null Het
Olfr109 C A 17: 37,466,616 Q137K probably benign Het
Olfr1150-ps1 A C 2: 87,846,459 K63Q probably damaging Het
Olfr129 T C 17: 38,055,109 I152M probably benign Het
Olfr271-ps1 T A 4: 52,936,113 K57* probably null Het
Olfr786 A C 10: 129,437,429 M206L probably benign Het
Pag1 T C 3: 9,699,539 T185A probably damaging Het
Palmd A T 3: 116,927,643 S100T probably damaging Het
Papln C A 12: 83,780,171 A690E probably benign Het
Pcdhga7 C T 18: 37,716,026 T362M probably benign Het
Pmpcb T A 5: 21,746,985 V286E possibly damaging Het
Pon3 T C 6: 5,236,940 I142M possibly damaging Het
Prdx6 A G 1: 161,241,816 S194P probably benign Het
Rapgef2 T C 3: 79,173,059 E112G probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rps6kb1 T A 11: 86,502,831 E491V probably benign Het
Sema3d C T 5: 12,584,934 Q656* probably null Het
Shisa6 A T 11: 66,218,006 D348E probably benign Het
Slc16a7 G T 10: 125,228,051 H472Q probably benign Het
Slc9a2 A G 1: 40,681,835 probably benign Het
Smad4 A G 18: 73,677,853 V20A probably damaging Het
Spata5 T C 3: 37,456,785 L697S probably damaging Het
Sstr3 G A 15: 78,539,843 R235W probably damaging Het
Svep1 T A 4: 58,064,248 H3245L possibly damaging Het
Tra2a G A 6: 49,250,985 R70* probably null Het
Trav7-4 G T 14: 53,461,467 V24L probably benign Het
Tsc2 C A 17: 24,600,031 S1278I probably damaging Het
Ubtf A G 11: 102,306,649 S726P unknown Het
Vmn2r42 A T 7: 8,184,221 Y851N probably benign Het
Wwp1 A G 4: 19,640,016 Y509H probably damaging Het
Xirp2 A C 2: 67,509,815 Q800P possibly damaging Het
Zc3h7b T C 15: 81,783,080 F609L probably benign Het
Zdhhc8 G T 16: 18,225,171 H388Q probably benign Het
Zfp644 T C 5: 106,638,526 K52E probably benign Het
Zfp82 T G 7: 30,056,895 E254A probably damaging Het
Other mutations in Ccdc175
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Ccdc175 APN 12 72131142 splice site probably benign
IGL01805:Ccdc175 APN 12 72129229 splice site probably benign
IGL01807:Ccdc175 APN 12 72159842 missense probably benign 0.02
IGL01985:Ccdc175 APN 12 72128278 nonsense probably null
IGL02719:Ccdc175 APN 12 72175125 missense probably damaging 0.97
IGL02944:Ccdc175 APN 12 72117893 missense probably benign 0.02
IGL03113:Ccdc175 APN 12 72144783 missense probably benign 0.00
IGL03143:Ccdc175 APN 12 72136058 missense probably benign 0.03
IGL03356:Ccdc175 APN 12 72139893 splice site probably null
R0009:Ccdc175 UTSW 12 72135965 missense possibly damaging 0.87
R0233:Ccdc175 UTSW 12 72105876 missense probably benign 0.00
R0233:Ccdc175 UTSW 12 72105876 missense probably benign 0.00
R0609:Ccdc175 UTSW 12 72157507 missense probably benign 0.07
R0706:Ccdc175 UTSW 12 72139948 missense probably benign 0.04
R0948:Ccdc175 UTSW 12 72131123 missense probably damaging 1.00
R1054:Ccdc175 UTSW 12 72178544 missense possibly damaging 0.85
R1166:Ccdc175 UTSW 12 72105932 missense probably damaging 1.00
R1481:Ccdc175 UTSW 12 72101948 unclassified probably benign
R1860:Ccdc175 UTSW 12 72105926 missense probably benign
R2077:Ccdc175 UTSW 12 72140020 missense possibly damaging 0.54
R3806:Ccdc175 UTSW 12 72180824 missense possibly damaging 0.72
R3879:Ccdc175 UTSW 12 72136018 missense probably damaging 1.00
R3887:Ccdc175 UTSW 12 72136048 missense possibly damaging 0.65
R4557:Ccdc175 UTSW 12 72128306 missense probably benign 0.08
R4585:Ccdc175 UTSW 12 72175179 missense possibly damaging 0.65
R4686:Ccdc175 UTSW 12 72112278 missense probably damaging 1.00
R4766:Ccdc175 UTSW 12 72112205 missense probably benign 0.00
R4773:Ccdc175 UTSW 12 72136048 missense probably damaging 0.99
R4909:Ccdc175 UTSW 12 72159753 missense probably damaging 1.00
R4964:Ccdc175 UTSW 12 72180845 missense probably damaging 1.00
R5338:Ccdc175 UTSW 12 72184971 missense probably damaging 0.99
R5539:Ccdc175 UTSW 12 72144813 missense probably benign 0.00
R5897:Ccdc175 UTSW 12 72159804 missense probably benign 0.06
R6128:Ccdc175 UTSW 12 72129159 missense probably benign 0.07
R6520:Ccdc175 UTSW 12 72140030 missense probably damaging 0.98
R6523:Ccdc175 UTSW 12 72144791 missense probably benign 0.01
R6917:Ccdc175 UTSW 12 72184905 missense probably damaging 1.00
R7035:Ccdc175 UTSW 12 72155645 missense probably benign 0.01
R7097:Ccdc175 UTSW 12 72128409 splice site probably null
R7339:Ccdc175 UTSW 12 72136041 missense probably damaging 1.00
R7481:Ccdc175 UTSW 12 72155624 missense probably benign 0.00
R7676:Ccdc175 UTSW 12 72102047 missense possibly damaging 0.57
R8045:Ccdc175 UTSW 12 72155902 intron probably benign
Z1088:Ccdc175 UTSW 12 72128379 missense probably benign 0.01
Z1176:Ccdc175 UTSW 12 72112308 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ACCATGATCTGTAGCCTCTACAAC -3'
(R):5'- ACTGCATTTAGACATCTACTCCATC -3'

Sequencing Primer
(F):5'- GATCTGTAGCCTCTACAACTGTAAAC -3'
(R):5'- ATTACTGCTGTGAACCCC -3'
Posted On2019-10-07