Incidental Mutation 'R7450:Zc3h7b'
ID577671
Institutional Source Beutler Lab
Gene Symbol Zc3h7b
Ensembl Gene ENSMUSG00000022390
Gene Namezinc finger CCCH type containing 7B
SynonymsScrg3
Accession Numbers

Genbank: NM_001081016; MGI: 1328310

Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R7450 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location81745057-81796260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81783080 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 609 (F609L)
Ref Sequence ENSEMBL: ENSMUSP00000105181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109554]
Predicted Effect probably benign
Transcript: ENSMUST00000109554
AA Change: F609L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105181
Gene: ENSMUSG00000022390
AA Change: F609L

DomainStartEndE-ValueType
Pfam:TPR_11 34 113 2.3e-12 PFAM
Pfam:TPR_1 82 115 2.4e-6 PFAM
Pfam:TPR_8 82 115 8.2e-4 PFAM
Pfam:TPR_8 116 143 4.8e-3 PFAM
low complexity region 294 309 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
ZnF_C3H1 482 508 2.15e1 SMART
ZnF_C3H1 612 638 2.03e1 SMART
ZnF_C3H1 757 782 8.31e0 SMART
ZnF_C2H2 843 867 2.86e-1 SMART
ZnF_C3H1 889 914 7.81e-1 SMART
low complexity region 959 981 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains a tetratricopeptide repeat domain. The encoded protein also interacts with the rotavirus non-structural protein NSP3. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(9) : Gene trapped(9)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T A 5: 113,184,111 R746W possibly damaging Het
Abcc2 T C 19: 43,822,039 L925P probably damaging Het
Abcc3 A T 11: 94,361,695 H787Q probably damaging Het
Acly A T 11: 100,479,275 V987E probably damaging Het
Cacna1b A T 2: 24,635,135 Y1676* probably null Het
Ccdc175 T A 12: 72,155,673 I283F possibly damaging Het
Cfap46 A T 7: 139,617,437 F2173I unknown Het
Cln6 G A 9: 62,850,630 E224K probably damaging Het
Cyp1a1 T A 9: 57,702,132 L372Q probably damaging Het
Dirc2 T C 16: 35,768,974 I90V possibly damaging Het
Dnah8 T A 17: 30,787,191 I3694N probably damaging Het
Dnal1 T C 12: 84,124,523 Y31H probably benign Het
Eid3 T A 10: 82,866,903 M66K probably benign Het
Epo T A 5: 137,483,235 E143D probably damaging Het
Fbxo25 C A 8: 13,931,235 N236K probably benign Het
Fsip2 A G 2: 82,951,680 I266V probably benign Het
Galnt6 T C 15: 100,697,815 Y444C probably damaging Het
Gm14139 A G 2: 150,193,126 T456A probably benign Het
Gm8251 A G 1: 44,058,773 V1055A probably benign Het
Gna11 T C 10: 81,532,522 Y160C Het
Hectd4 A T 5: 121,281,932 T647S probably benign Het
Hgd T C 16: 37,624,324 V316A possibly damaging Het
Idh3a T C 9: 54,596,083 V142A probably damaging Het
Il3ra T A 14: 14,351,090 I297N probably benign Het
Kcnj5 T G 9: 32,322,195 I275L possibly damaging Het
Kdm7a A T 6: 39,143,251 L928Q probably damaging Het
Kmo A G 1: 175,639,100 I75V probably benign Het
Krtap1-3 C A 11: 99,590,871 C150F unknown Het
Lingo3 C A 10: 80,834,837 E420* probably null Het
Lrrc37a A G 11: 103,498,326 V2091A probably benign Het
N4bp2 T A 5: 65,825,300 Y1632* probably null Het
Nlrp1a C A 11: 71,107,658 G905V probably damaging Het
Nlrp9c T A 7: 26,364,939 E988V probably benign Het
Nol8 T G 13: 49,660,015 H179Q probably benign Het
Notch3 G A 17: 32,141,391 P1522L possibly damaging Het
Nup210l T C 3: 90,115,188 probably null Het
Oas1b T A 5: 120,821,256 Y234* probably null Het
Olfr109 C A 17: 37,466,616 Q137K probably benign Het
Olfr1150-ps1 A C 2: 87,846,459 K63Q probably damaging Het
Olfr129 T C 17: 38,055,109 I152M probably benign Het
Olfr271-ps1 T A 4: 52,936,113 K57* probably null Het
Olfr786 A C 10: 129,437,429 M206L probably benign Het
Pag1 T C 3: 9,699,539 T185A probably damaging Het
Palmd A T 3: 116,927,643 S100T probably damaging Het
Papln C A 12: 83,780,171 A690E probably benign Het
Pcdhga7 C T 18: 37,716,026 T362M probably benign Het
Pmpcb T A 5: 21,746,985 V286E possibly damaging Het
Pon3 T C 6: 5,236,940 I142M possibly damaging Het
Prdx6 A G 1: 161,241,816 S194P probably benign Het
Rapgef2 T C 3: 79,173,059 E112G probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rps6kb1 T A 11: 86,502,831 E491V probably benign Het
Sema3d C T 5: 12,584,934 Q656* probably null Het
Shisa6 A T 11: 66,218,006 D348E probably benign Het
Slc16a7 G T 10: 125,228,051 H472Q probably benign Het
Slc9a2 A G 1: 40,681,835 probably benign Het
Smad4 A G 18: 73,677,853 V20A probably damaging Het
Spata5 T C 3: 37,456,785 L697S probably damaging Het
Sstr3 G A 15: 78,539,843 R235W probably damaging Het
Svep1 T A 4: 58,064,248 H3245L possibly damaging Het
Tra2a G A 6: 49,250,985 R70* probably null Het
Trav7-4 G T 14: 53,461,467 V24L probably benign Het
Tsc2 C A 17: 24,600,031 S1278I probably damaging Het
Ubtf A G 11: 102,306,649 S726P unknown Het
Vmn2r42 A T 7: 8,184,221 Y851N probably benign Het
Wwp1 A G 4: 19,640,016 Y509H probably damaging Het
Xirp2 A C 2: 67,509,815 Q800P possibly damaging Het
Zdhhc8 G T 16: 18,225,171 H388Q probably benign Het
Zfp644 T C 5: 106,638,526 K52E probably benign Het
Zfp82 T G 7: 30,056,895 E254A probably damaging Het
Other mutations in Zc3h7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Zc3h7b APN 15 81771799 missense possibly damaging 0.95
IGL01955:Zc3h7b APN 15 81792004 missense probably benign 0.10
IGL02526:Zc3h7b APN 15 81793137 missense probably benign 0.10
IGL02582:Zc3h7b APN 15 81769140 missense probably benign 0.05
IGL02736:Zc3h7b APN 15 81791974 missense probably benign 0.02
F6893:Zc3h7b UTSW 15 81778671 missense possibly damaging 0.94
R0212:Zc3h7b UTSW 15 81776328 missense probably benign 0.00
R0242:Zc3h7b UTSW 15 81768830 splice site probably benign
R0471:Zc3h7b UTSW 15 81781968 missense probably damaging 1.00
R0590:Zc3h7b UTSW 15 81776998 missense possibly damaging 0.74
R1530:Zc3h7b UTSW 15 81777088 missense probably benign
R1563:Zc3h7b UTSW 15 81777088 missense probably benign
R1565:Zc3h7b UTSW 15 81777088 missense probably benign
R1566:Zc3h7b UTSW 15 81768834 missense possibly damaging 0.91
R1670:Zc3h7b UTSW 15 81777067 missense probably benign
R1712:Zc3h7b UTSW 15 81777088 missense probably benign
R1727:Zc3h7b UTSW 15 81768029 missense probably damaging 1.00
R2069:Zc3h7b UTSW 15 81792328 missense probably damaging 0.98
R2375:Zc3h7b UTSW 15 81792502 missense probably benign 0.17
R2656:Zc3h7b UTSW 15 81780430 missense probably damaging 1.00
R4660:Zc3h7b UTSW 15 81792250 missense probably benign 0.07
R4764:Zc3h7b UTSW 15 81769183 critical splice donor site probably null
R4815:Zc3h7b UTSW 15 81793663 missense probably damaging 1.00
R4999:Zc3h7b UTSW 15 81779133 missense probably damaging 1.00
R5086:Zc3h7b UTSW 15 81793174 missense probably damaging 0.96
R5169:Zc3h7b UTSW 15 81773314 missense probably benign 0.01
R5395:Zc3h7b UTSW 15 81772501 missense possibly damaging 0.50
R5407:Zc3h7b UTSW 15 81785891 missense probably damaging 0.99
R5587:Zc3h7b UTSW 15 81771858 missense possibly damaging 0.80
R5721:Zc3h7b UTSW 15 81773298 missense probably benign 0.02
R6001:Zc3h7b UTSW 15 81792035 missense possibly damaging 0.89
R6151:Zc3h7b UTSW 15 81778710 critical splice donor site probably null
R6248:Zc3h7b UTSW 15 81783185 missense probably damaging 1.00
R6397:Zc3h7b UTSW 15 81792854 missense probably benign 0.03
R6502:Zc3h7b UTSW 15 81769051 missense probably benign 0.01
R7248:Zc3h7b UTSW 15 81771787 missense possibly damaging 0.46
R7397:Zc3h7b UTSW 15 81769153 missense possibly damaging 0.50
R7471:Zc3h7b UTSW 15 81780481 missense probably damaging 1.00
R7575:Zc3h7b UTSW 15 81777885 nonsense probably null
R7645:Zc3h7b UTSW 15 81780602 missense probably damaging 1.00
R7650:Zc3h7b UTSW 15 81793650 missense possibly damaging 0.81
R7881:Zc3h7b UTSW 15 81780478 missense probably damaging 1.00
R7918:Zc3h7b UTSW 15 81768988 missense probably damaging 0.98
R8001:Zc3h7b UTSW 15 81779260 nonsense probably null
R8504:Zc3h7b UTSW 15 81780518 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAAGCTCTGAGAATCGCCTC -3'
(R):5'- ACTCACCTGAGGTCCCATTC -3'

Sequencing Primer
(F):5'- TGAGAATCGCCTCCCCTCAG -3'
(R):5'- CCATTCGGTGGCCATCAG -3'
Posted On2019-10-07