Incidental Mutation 'R7450:Notch3'
ID577678
Institutional Source Beutler Lab
Gene Symbol Notch3
Ensembl Gene ENSMUSG00000038146
Gene Namenotch 3
SynonymsN3, hpbk
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7450 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location32120820-32166880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32141391 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1522 (P1522L)
Ref Sequence ENSEMBL: ENSMUSP00000085016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087723]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087723
AA Change: P1522L

PolyPhen 2 Score 0.693 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146
AA Change: P1522L

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
EGF 42 78 3.73e-5 SMART
EGF 82 119 1.78e-2 SMART
EGF 123 157 1.13e-4 SMART
EGF_CA 159 196 1.89e-15 SMART
EGF 201 235 3.85e-7 SMART
EGF_CA 237 273 3.97e-9 SMART
EGF_CA 275 313 4.63e-10 SMART
EGF_CA 315 351 1.05e-8 SMART
EGF 355 390 1.28e-3 SMART
EGF_CA 392 430 6.29e-12 SMART
EGF_CA 432 468 1.11e-12 SMART
EGF_CA 470 506 4.21e-13 SMART
EGF_CA 508 544 8.43e-13 SMART
EGF_CA 546 581 9.54e-12 SMART
EGF_CA 583 619 1.31e-9 SMART
EGF_CA 621 656 2.03e-6 SMART
EGF_CA 658 694 2.28e-9 SMART
EGF 699 731 7.18e-7 SMART
EGF 738 771 2.5e-6 SMART
EGF 775 809 8e-5 SMART
EGF_CA 811 848 4.77e-12 SMART
EGF_CA 850 886 3.81e-11 SMART
EGF_CA 888 923 1.47e-12 SMART
EGF_CA 925 961 3.4e-8 SMART
EGF 966 999 5.74e-6 SMART
EGF 1004 1035 7.18e-7 SMART
EGF 1040 1083 1.21e-4 SMART
EGF_CA 1085 1121 1.29e-8 SMART
EGF_CA 1123 1159 1.45e-11 SMART
EGF_CA 1161 1204 1.26e-11 SMART
EGF 1209 1245 1.53e-1 SMART
EGF 1250 1288 8e-5 SMART
EGF 1293 1326 1.13e1 SMART
EGF 1339 1374 5.36e-6 SMART
NL 1381 1419 1.63e-15 SMART
NL 1422 1460 1.78e-16 SMART
NL 1461 1502 1.75e-15 SMART
NOD 1506 1562 2.98e-24 SMART
NODP 1577 1641 1.34e-26 SMART
transmembrane domain 1644 1666 N/A INTRINSIC
low complexity region 1774 1783 N/A INTRINSIC
ANK 1789 1834 1.48e3 SMART
ANK 1839 1868 1.61e-4 SMART
ANK 1872 1902 1.42e0 SMART
ANK 1906 1935 1.77e-1 SMART
ANK 1939 1968 3.18e-3 SMART
ANK 1972 2001 5.16e-3 SMART
low complexity region 2028 2054 N/A INTRINSIC
low complexity region 2108 2123 N/A INTRINSIC
low complexity region 2169 2193 N/A INTRINSIC
DUF3454 2218 2275 2.81e-20 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T A 5: 113,184,111 R746W possibly damaging Het
Abcc2 T C 19: 43,822,039 L925P probably damaging Het
Abcc3 A T 11: 94,361,695 H787Q probably damaging Het
Acly A T 11: 100,479,275 V987E probably damaging Het
Cacna1b A T 2: 24,635,135 Y1676* probably null Het
Ccdc175 T A 12: 72,155,673 I283F possibly damaging Het
Cfap46 A T 7: 139,617,437 F2173I unknown Het
Cln6 G A 9: 62,850,630 E224K probably damaging Het
Cyp1a1 T A 9: 57,702,132 L372Q probably damaging Het
Dirc2 T C 16: 35,768,974 I90V possibly damaging Het
Dnah8 T A 17: 30,787,191 I3694N probably damaging Het
Dnal1 T C 12: 84,124,523 Y31H probably benign Het
Eid3 T A 10: 82,866,903 M66K probably benign Het
Epo T A 5: 137,483,235 E143D probably damaging Het
Fbxo25 C A 8: 13,931,235 N236K probably benign Het
Fsip2 A G 2: 82,951,680 I266V probably benign Het
Galnt6 T C 15: 100,697,815 Y444C probably damaging Het
Gm14139 A G 2: 150,193,126 T456A probably benign Het
Gm8251 A G 1: 44,058,773 V1055A probably benign Het
Gna11 T C 10: 81,532,522 Y160C Het
Hectd4 A T 5: 121,281,932 T647S probably benign Het
Hgd T C 16: 37,624,324 V316A possibly damaging Het
Idh3a T C 9: 54,596,083 V142A probably damaging Het
Il3ra T A 14: 14,351,090 I297N probably benign Het
Kcnj5 T G 9: 32,322,195 I275L possibly damaging Het
Kdm7a A T 6: 39,143,251 L928Q probably damaging Het
Kmo A G 1: 175,639,100 I75V probably benign Het
Krtap1-3 C A 11: 99,590,871 C150F unknown Het
Lingo3 C A 10: 80,834,837 E420* probably null Het
Lrrc37a A G 11: 103,498,326 V2091A probably benign Het
N4bp2 T A 5: 65,825,300 Y1632* probably null Het
Nlrp1a C A 11: 71,107,658 G905V probably damaging Het
Nlrp9c T A 7: 26,364,939 E988V probably benign Het
Nol8 T G 13: 49,660,015 H179Q probably benign Het
Nup210l T C 3: 90,115,188 probably null Het
Oas1b T A 5: 120,821,256 Y234* probably null Het
Olfr109 C A 17: 37,466,616 Q137K probably benign Het
Olfr1150-ps1 A C 2: 87,846,459 K63Q probably damaging Het
Olfr129 T C 17: 38,055,109 I152M probably benign Het
Olfr271-ps1 T A 4: 52,936,113 K57* probably null Het
Olfr786 A C 10: 129,437,429 M206L probably benign Het
Pag1 T C 3: 9,699,539 T185A probably damaging Het
Palmd A T 3: 116,927,643 S100T probably damaging Het
Papln C A 12: 83,780,171 A690E probably benign Het
Pcdhga7 C T 18: 37,716,026 T362M probably benign Het
Pmpcb T A 5: 21,746,985 V286E possibly damaging Het
Pon3 T C 6: 5,236,940 I142M possibly damaging Het
Prdx6 A G 1: 161,241,816 S194P probably benign Het
Rapgef2 T C 3: 79,173,059 E112G probably benign Het
Rasgrp1 T C 2: 117,287,943 I522V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Rps6kb1 T A 11: 86,502,831 E491V probably benign Het
Sema3d C T 5: 12,584,934 Q656* probably null Het
Shisa6 A T 11: 66,218,006 D348E probably benign Het
Slc16a7 G T 10: 125,228,051 H472Q probably benign Het
Slc9a2 A G 1: 40,681,835 probably benign Het
Smad4 A G 18: 73,677,853 V20A probably damaging Het
Spata5 T C 3: 37,456,785 L697S probably damaging Het
Sstr3 G A 15: 78,539,843 R235W probably damaging Het
Svep1 T A 4: 58,064,248 H3245L possibly damaging Het
Tra2a G A 6: 49,250,985 R70* probably null Het
Trav7-4 G T 14: 53,461,467 V24L probably benign Het
Tsc2 C A 17: 24,600,031 S1278I probably damaging Het
Ubtf A G 11: 102,306,649 S726P unknown Het
Vmn2r42 A T 7: 8,184,221 Y851N probably benign Het
Wwp1 A G 4: 19,640,016 Y509H probably damaging Het
Xirp2 A C 2: 67,509,815 Q800P possibly damaging Het
Zc3h7b T C 15: 81,783,080 F609L probably benign Het
Zdhhc8 G T 16: 18,225,171 H388Q probably benign Het
Zfp644 T C 5: 106,638,526 K52E probably benign Het
Zfp82 T G 7: 30,056,895 E254A probably damaging Het
Other mutations in Notch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Notch3 APN 17 32158114 nonsense probably null
IGL01065:Notch3 APN 17 32146416 nonsense probably null
IGL01296:Notch3 APN 17 32166757 missense unknown
IGL01322:Notch3 APN 17 32144471 missense probably damaging 1.00
IGL01343:Notch3 APN 17 32143436 missense probably benign 0.10
IGL01358:Notch3 APN 17 32144747 missense probably damaging 1.00
IGL01600:Notch3 APN 17 32144498 missense probably damaging 1.00
IGL01622:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01623:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01971:Notch3 APN 17 32124347 missense probably damaging 1.00
IGL02000:Notch3 APN 17 32122742 missense probably damaging 0.99
IGL02072:Notch3 APN 17 32147074 nonsense probably null
IGL02145:Notch3 APN 17 32154741 missense probably benign 0.01
IGL02256:Notch3 APN 17 32132324 missense probably damaging 1.00
IGL02366:Notch3 APN 17 32144205 missense probably benign
IGL02476:Notch3 APN 17 32158638 missense possibly damaging 0.67
IGL02502:Notch3 APN 17 32158278 nonsense probably null
IGL02551:Notch3 APN 17 32154731 splice site probably benign
divide UTSW 17 32137813 splice site probably null
Lopressor UTSW 17 32153884 missense probably damaging 1.00
PIT4486001:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R0115:Notch3 UTSW 17 32133462 missense possibly damaging 0.82
R0201:Notch3 UTSW 17 32156148 splice site probably benign
R0630:Notch3 UTSW 17 32147472 splice site probably benign
R1167:Notch3 UTSW 17 32122745 missense possibly damaging 0.95
R1432:Notch3 UTSW 17 32164224 missense probably benign
R1567:Notch3 UTSW 17 32158580 missense possibly damaging 0.77
R1623:Notch3 UTSW 17 32139191 missense probably benign 0.00
R1663:Notch3 UTSW 17 32156119 missense probably damaging 1.00
R1668:Notch3 UTSW 17 32158589 missense probably damaging 0.99
R1789:Notch3 UTSW 17 32158725 missense probably damaging 1.00
R1813:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1837:Notch3 UTSW 17 32124322 missense probably damaging 1.00
R1896:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1937:Notch3 UTSW 17 32153852 missense probably benign 0.03
R1954:Notch3 UTSW 17 32166678 missense probably benign
R2014:Notch3 UTSW 17 32158000 missense probably benign 0.00
R2058:Notch3 UTSW 17 32143644 missense probably benign
R2068:Notch3 UTSW 17 32135508 missense probably benign 0.00
R2097:Notch3 UTSW 17 32122754 missense probably damaging 1.00
R2112:Notch3 UTSW 17 32144610 missense probably benign 0.19
R2156:Notch3 UTSW 17 32147844 missense probably damaging 1.00
R2211:Notch3 UTSW 17 32147978 missense probably benign 0.00
R2324:Notch3 UTSW 17 32150134 splice site probably benign
R2432:Notch3 UTSW 17 32153804 missense probably damaging 1.00
R3117:Notch3 UTSW 17 32158115 missense probably damaging 1.00
R3236:Notch3 UTSW 17 32158461 missense probably damaging 0.96
R3409:Notch3 UTSW 17 32150702 missense possibly damaging 0.67
R3434:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3435:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3438:Notch3 UTSW 17 32153590 missense probably damaging 1.00
R3926:Notch3 UTSW 17 32153557 missense possibly damaging 0.92
R4087:Notch3 UTSW 17 32158113 missense possibly damaging 0.60
R4115:Notch3 UTSW 17 32158433 missense probably damaging 1.00
R4214:Notch3 UTSW 17 32132207 missense possibly damaging 0.96
R4234:Notch3 UTSW 17 32141341 missense probably damaging 0.97
R4242:Notch3 UTSW 17 32143745 missense possibly damaging 0.74
R4658:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R4878:Notch3 UTSW 17 32147085 missense probably damaging 1.00
R4879:Notch3 UTSW 17 32147963 missense probably benign 0.00
R4885:Notch3 UTSW 17 32141377 missense probably damaging 0.98
R4924:Notch3 UTSW 17 32144731 missense probably damaging 1.00
R5084:Notch3 UTSW 17 32157890 critical splice donor site probably null
R5086:Notch3 UTSW 17 32143334 missense probably benign 0.13
R5343:Notch3 UTSW 17 32143283 missense probably benign 0.03
R5389:Notch3 UTSW 17 32139189 missense probably benign
R5503:Notch3 UTSW 17 32147055 missense probably benign 0.00
R5698:Notch3 UTSW 17 32157987 missense probably damaging 1.00
R5824:Notch3 UTSW 17 32153861 missense possibly damaging 0.92
R5969:Notch3 UTSW 17 32153884 missense probably damaging 1.00
R6050:Notch3 UTSW 17 32143527 missense probably benign
R6274:Notch3 UTSW 17 32147290 missense probably benign
R6276:Notch3 UTSW 17 32154749 missense probably benign 0.10
R6313:Notch3 UTSW 17 32151154 intron probably null
R6316:Notch3 UTSW 17 32137813 splice site probably null
R6380:Notch3 UTSW 17 32144559 missense probably damaging 1.00
R6401:Notch3 UTSW 17 32158623 missense probably benign 0.01
R6502:Notch3 UTSW 17 32158217 missense probably damaging 1.00
R6741:Notch3 UTSW 17 32143484 missense probably benign 0.16
R7131:Notch3 UTSW 17 32144217 missense probably benign
R7140:Notch3 UTSW 17 32156377 missense possibly damaging 0.84
R7162:Notch3 UTSW 17 32146449 missense probably damaging 0.98
R7171:Notch3 UTSW 17 32158962 missense probably damaging 1.00
R7449:Notch3 UTSW 17 32157966 missense probably damaging 1.00
R7554:Notch3 UTSW 17 32122371 missense probably benign 0.03
R7575:Notch3 UTSW 17 32154819 missense possibly damaging 0.81
R7632:Notch3 UTSW 17 32158506 missense probably benign
R7633:Notch3 UTSW 17 32158622 missense probably benign 0.17
T0975:Notch3 UTSW 17 32146417 missense probably damaging 0.99
Z1088:Notch3 UTSW 17 32158652 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AAGACGCCTTGCCAAGAGAG -3'
(R):5'- GTGACCCGAAGAATCTCTGAG -3'

Sequencing Primer
(F):5'- AGCTCTCAACTAAGAAGCGTG -3'
(R):5'- ACCCGAAGAATCTCTGAGTTTGTG -3'
Posted On2019-10-07