Incidental Mutation 'R0629:Adamts14'
ID 57768
Institutional Source Beutler Lab
Gene Symbol Adamts14
Ensembl Gene ENSMUSG00000059901
Gene Name a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 14
Synonyms Adamts-14, TS14
MMRRC Submission 038818-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0629 (G1)
Quality Score 169
Status Validated
Chromosome 10
Chromosomal Location 61197112-61273438 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 61211624 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 733 (Q733*)
Ref Sequence ENSEMBL: ENSMUSP00000112723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092486] [ENSMUST00000120336]
AlphaFold E9PX39
Predicted Effect probably null
Transcript: ENSMUST00000092486
AA Change: Q730*
SMART Domains Protein: ENSMUSP00000090143
Gene: ENSMUSG00000059901
AA Change: Q730*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 194 6.3e-30 PFAM
Pfam:Reprolysin_5 245 424 6e-17 PFAM
Pfam:Reprolysin_4 246 432 2.5e-7 PFAM
Pfam:Reprolysin 246 447 1.9e-21 PFAM
Pfam:Reprolysin_2 264 437 9.2e-10 PFAM
Pfam:Reprolysin_3 268 396 2.5e-12 PFAM
TSP1 542 594 5.9e-16 SMART
Pfam:ADAM_spacer1 701 816 1.8e-24 PFAM
TSP1 837 894 2.1e-2 SMART
TSP1 897 956 3.42e-3 SMART
TSP1 959 1009 4.48e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120336
AA Change: Q733*
SMART Domains Protein: ENSMUSP00000112723
Gene: ENSMUSG00000059901
AA Change: Q733*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 194 1.6e-38 PFAM
Pfam:Reprolysin_5 245 427 5.9e-16 PFAM
Pfam:Reprolysin_4 246 435 1.1e-7 PFAM
Pfam:Reprolysin 246 450 3.2e-20 PFAM
Pfam:Reprolysin_2 264 441 5.5e-12 PFAM
Pfam:Reprolysin_3 268 399 1.5e-13 PFAM
TSP1 545 597 5.9e-16 SMART
Pfam:ADAM_spacer1 704 819 8e-25 PFAM
TSP1 840 897 2.1e-2 SMART
TSP1 900 959 3.42e-3 SMART
TSP1 962 1012 4.48e-7 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motif) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme cleaves amino-terminal propeptides from type I procollagen, a necessary step in the formation of collagen fibers. Mutations in this gene may be associated with osteoarthritis in human patients. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Adamts14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Adamts14 APN 10 61229676 missense probably damaging 1.00
IGL00800:Adamts14 APN 10 61205418 missense probably benign 0.00
IGL01021:Adamts14 APN 10 61225373 missense probably damaging 0.99
IGL01022:Adamts14 APN 10 61202942 missense probably benign 0.01
IGL01335:Adamts14 APN 10 61198681 missense possibly damaging 0.90
IGL01419:Adamts14 APN 10 61205542 splice site probably benign
IGL01595:Adamts14 APN 10 61205473 missense probably damaging 1.00
R0594:Adamts14 UTSW 10 61202887 missense probably damaging 1.00
R1459:Adamts14 UTSW 10 61198804 missense probably benign 0.13
R1565:Adamts14 UTSW 10 61270897 missense probably damaging 1.00
R1686:Adamts14 UTSW 10 61198660 missense probably benign
R1792:Adamts14 UTSW 10 61218498 missense probably benign 0.07
R1876:Adamts14 UTSW 10 61200372 missense probably benign 0.03
R1992:Adamts14 UTSW 10 61198660 missense probably benign
R2064:Adamts14 UTSW 10 61205522 missense probably benign 0.24
R2495:Adamts14 UTSW 10 61198970 splice site probably null
R2848:Adamts14 UTSW 10 61218435 missense probably damaging 1.00
R2897:Adamts14 UTSW 10 61204910 missense probably damaging 0.99
R3428:Adamts14 UTSW 10 61224374 missense probably benign 0.36
R4006:Adamts14 UTSW 10 61202821 critical splice donor site probably null
R5129:Adamts14 UTSW 10 61249618 missense probably benign 0.02
R5327:Adamts14 UTSW 10 61198488 missense probably benign 0.01
R5524:Adamts14 UTSW 10 61230443 missense probably damaging 1.00
R5594:Adamts14 UTSW 10 61227101 splice site probably null
R5694:Adamts14 UTSW 10 61229652 missense probably benign 0.45
R5801:Adamts14 UTSW 10 61202996 missense probably damaging 0.99
R5941:Adamts14 UTSW 10 61221895 missense probably damaging 1.00
R5953:Adamts14 UTSW 10 61207446 missense probably damaging 0.99
R6778:Adamts14 UTSW 10 61225452 missense probably damaging 1.00
R7169:Adamts14 UTSW 10 61204928 missense probably damaging 0.97
R7215:Adamts14 UTSW 10 61211596 missense possibly damaging 0.89
R7337:Adamts14 UTSW 10 61207460 missense probably damaging 0.98
R7511:Adamts14 UTSW 10 61218528 missense possibly damaging 0.74
R7640:Adamts14 UTSW 10 61246057 missense probably benign 0.00
R7798:Adamts14 UTSW 10 61271173 missense probably damaging 0.99
R7902:Adamts14 UTSW 10 61205397 missense possibly damaging 0.92
R8062:Adamts14 UTSW 10 61200361 critical splice donor site probably null
R8284:Adamts14 UTSW 10 61198659 missense possibly damaging 0.55
R8319:Adamts14 UTSW 10 61221927 missense probably benign
R8475:Adamts14 UTSW 10 61202887 missense probably damaging 1.00
R8494:Adamts14 UTSW 10 61202929 missense probably benign 0.03
R8519:Adamts14 UTSW 10 61202840 missense possibly damaging 0.84
R8547:Adamts14 UTSW 10 61271219 missense probably damaging 1.00
R8797:Adamts14 UTSW 10 61271002 missense probably benign 0.44
R8978:Adamts14 UTSW 10 61203016 missense probably damaging 0.96
R9023:Adamts14 UTSW 10 61203001 missense probably damaging 1.00
R9067:Adamts14 UTSW 10 61249660 missense possibly damaging 0.78
R9326:Adamts14 UTSW 10 61200459 missense probably benign 0.00
R9641:Adamts14 UTSW 10 61271050 missense probably damaging 1.00
R9785:Adamts14 UTSW 10 61213648 missense possibly damaging 0.83
Z1088:Adamts14 UTSW 10 61218445 missense probably damaging 1.00
Z1177:Adamts14 UTSW 10 61198843 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGAGCCCTTCTGCGAAATGACTC -3'
(R):5'- AAGAATCCAACCCTGGTTTCCAGC -3'

Sequencing Primer
(F):5'- AACAGCGGTTGATCCTGG -3'
(R):5'- TTTCCAGCCAAGGAAACAGG -3'
Posted On 2013-07-11