Mutagenetix > Incidental Mutations

Incidental Mutation 'R7451:Pla2r1'

577692

Institutional Source

Beutler Lab

Gene Symbol

Pla2r1

Ensembl Gene

ENSMUSG00000054580

Gene Name

phospholipase A2 receptor 1

Synonyms

M-type receptor, Pla2g1br, PLA2-I receptor

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7451 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60417543-60553308 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 60535002 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 75 (M75L)

Ref Sequence

ENSEMBL: ENSMUSP00000108144 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112525]

Predicted Effect

probably damaging
Transcript: ENSMUST00000112525
AA Change: M75L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108144
Gene: ENSMUSG00000054580
AA Change: M75L

Domain	Start	End	E-Value	Type
low complexity region	35	62	N/A	INTRINSIC
RICIN	77	189	2.98e-16	SMART
FN2	209	257	1.17e-25	SMART
CLECT	267	392	7.66e-30	SMART
CLECT	415	539	1.88e-29	SMART
CLECT	552	679	5.42e-21	SMART
CLECT	699	832	3.58e-21	SMART
CLECT	847	973	7.55e-20	SMART
CLECT	992	1131	5.05e-30	SMART
CLECT	1148	1267	4.72e-21	SMART
CLECT	1281	1412	1.44e-25	SMART
transmembrane domain	1432	1454	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (84/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a phospholipase A2 receptor. The encoded protein likely exists as both a transmembrane form and a soluble form. The transmembrane receptor may play a role in clearance of phospholipase A2, thereby inhibiting its action. Polymorphisms at this locus have been associated with susceptibility to idiopathic membranous nephropathy. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null mice are viable and fertile with no overt abnormalities. These mice are more resistant to toxic effects of lipopolysaccharide than controls, suggesting a role for this gene in the progression of endotoxic shock. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	A	T	11: 101,991,457	N147I	possibly damaging	Het
4932438A13Rik	G	T	3: 37,022,807		probably null	Het
Abcb6	A	G	1: 75,172,153	I794T	probably damaging	Het
Abcc5	T	A	16: 20,375,070	H767L	probably damaging	Het
Adgrb2	A	T	4: 130,014,557	M1031L	probably damaging	Het
Akna	T	A	4: 63,378,667	M891L	probably benign	Het
Aloxe3	C	A	11: 69,142,920	T620K	possibly damaging	Het
Amph	A	G	13: 19,077,368	Y63C	probably damaging	Het
Asprv1	A	G	6: 86,628,948	I259V	probably benign	Het
Atp7b	C	T	8: 22,014,684	W652*	probably null	Het
Atp8a2	C	T	14: 59,791,181	D946N	probably null	Het
BC024063	T	A	10: 82,108,742	N65K	probably benign	Het
Bean1	A	T	8: 104,213,996	M154L	probably benign	Het
Cacna1c	C	T	6: 118,594,020	V2181M	unknown	Het
Cacna1g	A	G	11: 94,429,075	I1425T	probably damaging	Het
Caskin2	A	G	11: 115,812,155		probably benign	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cfd	T	A	10: 79,891,528	V43E	probably damaging	Het
Chd9	GCCCC	GCCC	8: 91,033,790		probably null	Het
Chd9	T	A	8: 91,033,818	S2064T	probably benign	Het
Cpsf2	T	G	12: 102,000,792	V646G	possibly damaging	Het
Ctif	T	C	18: 75,519,803	D461G	possibly damaging	Het
Cyp3a41a	T	A	5: 145,699,740	E414D	probably benign	Het
Dagla	A	G	19: 10,253,355	V544A	probably damaging	Het
Dhx57	A	T	17: 80,247,113	V1228E	probably damaging	Het
Eif2b3	T	A	4: 117,052,796	L176*	probably null	Het
Fbxw26	T	A	9: 109,732,623	I168L	probably benign	Het
Flt3	T	A	5: 147,349,667	Y703F	probably damaging	Het
Frmpd1	C	T	4: 45,279,558	P761L	probably benign	Het
Gabrd	A	G	4: 155,388,459	V89A	possibly damaging	Het
Galnt14	A	T	17: 73,574,809	H98Q	probably benign	Het
Gli3	T	C	13: 15,726,291	V1421A	possibly damaging	Het
Gprin2	A	G	14: 34,195,805	S3P	probably damaging	Het
Ifi211	T	G	1: 173,899,492	D362A	probably damaging	Het
Lars	G	T	18: 42,202,550	T1167K	probably benign	Het
Lce1b	T	C	3: 92,655,900	S109G	unknown	Het
Lrp2	T	G	2: 69,513,333	E894A	probably damaging	Het
Mamdc4	A	G	2: 25,564,461	V1081A	possibly damaging	Het
Mcub	T	C	3: 129,917,103	S227G	possibly damaging	Het
Mki67	A	G	7: 135,699,351	I1318T	probably benign	Het
Mybl2	C	T	2: 163,072,706	T248I	possibly damaging	Het
Myo9b	A	T	8: 71,352,188	H1441L	probably benign	Het
Nav2	T	A	7: 49,552,829		probably null	Het
Neb	C	T	2: 52,201,454	V5339I	probably benign	Het
Nktr	T	A	9: 121,729,656	S88T	probably damaging	Het
Nup155	C	T	15: 8,145,607	Q963*	probably null	Het
Oas1c	A	C	5: 120,802,142	L320V	possibly damaging	Het
Olfr108	C	A	17: 37,446,305	S261R	probably damaging	Het
Olfr1254	A	G	2: 89,789,109	M81T	probably benign	Het
Olfr1338	C	T	4: 118,753,687	A286T	probably benign	Het
Olfr149	G	A	9: 39,702,127	T214I	probably damaging	Het
Olfr325	A	G	11: 58,581,690	Y282C	probably damaging	Het
Olfr548-ps1	T	C	7: 102,542,254	I106T	probably benign	Het
Pcdhga7	A	G	18: 37,716,004	S355G	possibly damaging	Het
Pde11a	C	T	2: 76,022,773	V834I	possibly damaging	Het
Pdzrn4	A	T	15: 92,770,067	D700V	possibly damaging	Het
Pif1	C	A	9: 65,588,348	P180Q	probably benign	Het
Pkig	G	T	2: 163,721,163	E5*	probably null	Het
Pllp	T	C	8: 94,676,243	S157G	probably damaging	Het
Ppfia1	A	T	7: 144,508,210	H566Q	probably benign	Het
Ptpn13	A	G	5: 103,527,095	D646G	probably benign	Het
Rab11fip5	T	A	6: 85,341,556	T784S	probably benign	Het
Rad51ap2	T	G	12: 11,457,981	S635A	probably benign	Het
Ranbp17	A	T	11: 33,284,114		probably null	Het
Rce1	C	T	19: 4,625,053	G111D	probably damaging	Het
Rcor3	C	A	1: 192,137,876	G8V	probably damaging	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rimbp2	C	T	5: 128,788,371	V631I	probably benign	Het
Scai	T	C	2: 39,125,136	T94A	probably damaging	Het
Sfmbt1	G	A	14: 30,816,811	A796T	probably benign	Het
Slc6a11	C	A	6: 114,245,683	Y546*	probably null	Het
Slc7a2	T	C	8: 40,912,649	S506P	probably damaging	Het
Synj2	T	A	17: 6,029,791	N1098K	possibly damaging	Het
Tmem177	G	A	1: 119,910,241	A236V	probably damaging	Het
Togaram1	T	A	12: 64,996,975	D1249E	probably damaging	Het
Trav17	A	T	14: 53,806,639	M1L	probably damaging	Het
Trim25	C	A	11: 89,015,737	A433D	possibly damaging	Het
Trim69	T	C	2: 122,168,027	F160S	probably benign	Het
Trio	A	T	15: 27,747,913	V1407E	probably benign	Het
Trpm7	A	T	2: 126,826,737	M753K	probably damaging	Het
Ttc12	G	T	9: 49,471,879	A75E	probably benign	Het
Uchl4	A	T	9: 64,235,731	I165L	probably benign	Het
Uvrag	A	T	7: 99,140,913	L13Q	unknown	Het
Wwc2	G	A	8: 47,864,575	R656W	not run	Het

Other mutations in Pla2r1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Pla2r1	APN	2	60420425	missense	probably benign
IGL00886:Pla2r1	APN	2	60424324	missense	probably damaging	1.00
IGL00928:Pla2r1	APN	2	60535080	missense	probably damaging	0.99
IGL01361:Pla2r1	APN	2	60479470	missense	probably damaging	1.00
IGL01403:Pla2r1	APN	2	60424288	missense	probably damaging	0.99
IGL01475:Pla2r1	APN	2	60441081	splice site	probably benign
IGL01517:Pla2r1	APN	2	60504253	missense	probably damaging	1.00
IGL01646:Pla2r1	APN	2	60495364	missense	probably damaging	1.00
IGL02208:Pla2r1	APN	2	60428588	missense	possibly damaging	0.81
IGL02301:Pla2r1	APN	2	60452436	missense	probably benign	0.01
IGL02522:Pla2r1	APN	2	60428669	missense	probably benign	0.11
IGL02688:Pla2r1	APN	2	60455201	missense	probably damaging	1.00
IGL02822:Pla2r1	APN	2	60455173	missense	probably damaging	1.00
IGL02850:Pla2r1	APN	2	60502069	missense	probably benign	0.03
IGL03233:Pla2r1	APN	2	60428580	missense	possibly damaging	0.63
IGL03350:Pla2r1	APN	2	60455173	missense	probably damaging	1.00
IGL02980:Pla2r1	UTSW	2	60515046	missense	possibly damaging	0.77
R0105:Pla2r1	UTSW	2	60514981	missense	possibly damaging	0.89
R0105:Pla2r1	UTSW	2	60514981	missense	possibly damaging	0.89
R0387:Pla2r1	UTSW	2	60432601	missense	probably benign	0.03
R0522:Pla2r1	UTSW	2	60479515	missense	probably benign	0.01
R0550:Pla2r1	UTSW	2	60425350	critical splice donor site	probably null
R0718:Pla2r1	UTSW	2	60479530	missense	possibly damaging	0.55
R0906:Pla2r1	UTSW	2	60514947	missense	possibly damaging	0.79
R0945:Pla2r1	UTSW	2	60458410	missense	possibly damaging	0.89
R1229:Pla2r1	UTSW	2	60534762	missense	probably benign	0.09
R1397:Pla2r1	UTSW	2	60534762	missense	probably benign	0.09
R1667:Pla2r1	UTSW	2	60420257	missense	probably benign	0.00
R1668:Pla2r1	UTSW	2	60428646	missense	probably damaging	0.99
R1694:Pla2r1	UTSW	2	60441084	critical splice donor site	probably null
R1864:Pla2r1	UTSW	2	60428711	missense	probably benign	0.01
R2029:Pla2r1	UTSW	2	60431973	missense	probably damaging	0.99
R2035:Pla2r1	UTSW	2	60422736	missense	probably damaging	1.00
R2207:Pla2r1	UTSW	2	60458435	missense	probably damaging	1.00
R2429:Pla2r1	UTSW	2	60514968	missense	probably damaging	1.00
R3196:Pla2r1	UTSW	2	60522783	missense	probably damaging	1.00
R3522:Pla2r1	UTSW	2	60448906	missense	probably damaging	1.00
R3973:Pla2r1	UTSW	2	60448962	missense	probably benign	0.30
R4006:Pla2r1	UTSW	2	60522873	missense	probably damaging	1.00
R4091:Pla2r1	UTSW	2	60432593	missense	probably damaging	1.00
R4158:Pla2r1	UTSW	2	60422622	missense	probably damaging	0.97
R4160:Pla2r1	UTSW	2	60422622	missense	probably damaging	0.97
R4168:Pla2r1	UTSW	2	60497614	nonsense	probably null
R4541:Pla2r1	UTSW	2	60427738	missense	probably damaging	1.00
R4712:Pla2r1	UTSW	2	60428650	missense	probably damaging	1.00
R4797:Pla2r1	UTSW	2	60504180	missense	possibly damaging	0.47
R4884:Pla2r1	UTSW	2	60534984	missense	probably damaging	1.00
R4923:Pla2r1	UTSW	2	60422712	missense	probably benign	0.31
R5017:Pla2r1	UTSW	2	60522760	splice site	probably null
R5116:Pla2r1	UTSW	2	60448906	missense	probably damaging	1.00
R5641:Pla2r1	UTSW	2	60514984	missense	probably damaging	1.00
R5807:Pla2r1	UTSW	2	60428721	missense	possibly damaging	0.78
R5898:Pla2r1	UTSW	2	60422760	missense	probably damaging	1.00
R6241:Pla2r1	UTSW	2	60502199	splice site	probably null
R6923:Pla2r1	UTSW	2	60514966	missense	probably benign	0.11
R7020:Pla2r1	UTSW	2	60447399	missense	possibly damaging	0.79
R7028:Pla2r1	UTSW	2	60458393	missense	probably damaging	0.98
R7257:Pla2r1	UTSW	2	60427625	critical splice donor site	probably null
R7291:Pla2r1	UTSW	2	60530435	missense	probably benign	0.43
R7350:Pla2r1	UTSW	2	60458379	missense	probably benign	0.02
R7553:Pla2r1	UTSW	2	60522899	missense	possibly damaging	0.80
R7635:Pla2r1	UTSW	2	60534762	missense	probably benign	0.09
R7768:Pla2r1	UTSW	2	60448946	missense	probably benign	0.22
R7774:Pla2r1	UTSW	2	60530458	nonsense	probably null
R7782:Pla2r1	UTSW	2	60504187	missense	probably benign	0.01
R7832:Pla2r1	UTSW	2	60504192	missense	possibly damaging	0.79
R7843:Pla2r1	UTSW	2	60447475	missense	possibly damaging	0.88
R7900:Pla2r1	UTSW	2	60428514	missense	possibly damaging	0.94
R8010:Pla2r1	UTSW	2	60514960	missense	probably benign	0.00
R8129:Pla2r1	UTSW	2	60432600	missense	probably damaging	1.00
R8336:Pla2r1	UTSW	2	60422683	missense	possibly damaging	0.88
R8347:Pla2r1	UTSW	2	60534903	missense	probably damaging	0.98
R8359:Pla2r1	UTSW	2	60443283	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CTGGACCTTGTACTGGAGTG -3'
(R):5'- AAAATGACTGGCAGCTGTGAC -3'

Sequencing Primer
(F):5'- GAGTGGGCCCTCGATCATCTTC -3'
(R):5'- GGCTTAGATACACACACTGGGATC -3'

Posted On

2019-10-07