Incidental Mutation 'R7451:Trpm7'
ID577697
Institutional Source Beutler Lab
Gene Symbol Trpm7
Ensembl Gene ENSMUSG00000027365
Gene Nametransient receptor potential cation channel, subfamily M, member 7
SynonymsLTRPC7, 2310022G15Rik, CHAK, CHAK1, Ltpr7, 4833414K03Rik, 5033407O22Rik, TRP-PLIK
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7451 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location126791565-126876230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126826737 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 753 (M753K)
Ref Sequence ENSEMBL: ENSMUSP00000099513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]
PDB Structure
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028843
AA Change: M753K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365
AA Change: M753K

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
Pfam:Ion_trans 887 1096 3e-8 PFAM
PDB:3E7K|H 1198 1249 6e-27 PDB
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1545 6e-64 BLAST
Alpha_kinase 1596 1813 3.77e-89 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000103224
AA Change: M753K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365
AA Change: M753K

DomainStartEndE-ValueType
Blast:ANK 438 467 5e-6 BLAST
low complexity region 541 555 N/A INTRINSIC
transmembrane domain 757 774 N/A INTRINSIC
Pfam:Ion_trans 855 1108 1.7e-9 PFAM
Pfam:TRPM_tetra 1194 1249 3.3e-29 PFAM
low complexity region 1385 1397 N/A INTRINSIC
Blast:Alpha_kinase 1398 1546 2e-64 BLAST
Alpha_kinase 1597 1814 3.77e-89 SMART
Meta Mutation Damage Score 0.2003 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,457 N147I possibly damaging Het
4932438A13Rik G T 3: 37,022,807 probably null Het
Abcb6 A G 1: 75,172,153 I794T probably damaging Het
Abcc5 T A 16: 20,375,070 H767L probably damaging Het
Adgrb2 A T 4: 130,014,557 M1031L probably damaging Het
Akna T A 4: 63,378,667 M891L probably benign Het
Aloxe3 C A 11: 69,142,920 T620K possibly damaging Het
Amph A G 13: 19,077,368 Y63C probably damaging Het
Asprv1 A G 6: 86,628,948 I259V probably benign Het
Atp7b C T 8: 22,014,684 W652* probably null Het
Atp8a2 C T 14: 59,791,181 D946N probably null Het
BC024063 T A 10: 82,108,742 N65K probably benign Het
Bean1 A T 8: 104,213,996 M154L probably benign Het
Cacna1c C T 6: 118,594,020 V2181M unknown Het
Cacna1g A G 11: 94,429,075 I1425T probably damaging Het
Caskin2 A G 11: 115,812,155 probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfd T A 10: 79,891,528 V43E probably damaging Het
Chd9 GCCCC GCCC 8: 91,033,790 probably null Het
Chd9 T A 8: 91,033,818 S2064T probably benign Het
Cpsf2 T G 12: 102,000,792 V646G possibly damaging Het
Ctif T C 18: 75,519,803 D461G possibly damaging Het
Cyp3a41a T A 5: 145,699,740 E414D probably benign Het
Dagla A G 19: 10,253,355 V544A probably damaging Het
Dhx57 A T 17: 80,247,113 V1228E probably damaging Het
Eif2b3 T A 4: 117,052,796 L176* probably null Het
Fbxw26 T A 9: 109,732,623 I168L probably benign Het
Flt3 T A 5: 147,349,667 Y703F probably damaging Het
Frmpd1 C T 4: 45,279,558 P761L probably benign Het
Gabrd A G 4: 155,388,459 V89A possibly damaging Het
Galnt14 A T 17: 73,574,809 H98Q probably benign Het
Gli3 T C 13: 15,726,291 V1421A possibly damaging Het
Gprin2 A G 14: 34,195,805 S3P probably damaging Het
Ifi211 T G 1: 173,899,492 D362A probably damaging Het
Lars G T 18: 42,202,550 T1167K probably benign Het
Lce1b T C 3: 92,655,900 S109G unknown Het
Lrp2 T G 2: 69,513,333 E894A probably damaging Het
Mamdc4 A G 2: 25,564,461 V1081A possibly damaging Het
Mcub T C 3: 129,917,103 S227G possibly damaging Het
Mki67 A G 7: 135,699,351 I1318T probably benign Het
Mybl2 C T 2: 163,072,706 T248I possibly damaging Het
Myo9b A T 8: 71,352,188 H1441L probably benign Het
Nav2 T A 7: 49,552,829 probably null Het
Neb C T 2: 52,201,454 V5339I probably benign Het
Nktr T A 9: 121,729,656 S88T probably damaging Het
Nup155 C T 15: 8,145,607 Q963* probably null Het
Oas1c A C 5: 120,802,142 L320V possibly damaging Het
Olfr108 C A 17: 37,446,305 S261R probably damaging Het
Olfr1254 A G 2: 89,789,109 M81T probably benign Het
Olfr1338 C T 4: 118,753,687 A286T probably benign Het
Olfr149 G A 9: 39,702,127 T214I probably damaging Het
Olfr325 A G 11: 58,581,690 Y282C probably damaging Het
Olfr548-ps1 T C 7: 102,542,254 I106T probably benign Het
Pcdhga7 A G 18: 37,716,004 S355G possibly damaging Het
Pde11a C T 2: 76,022,773 V834I possibly damaging Het
Pdzrn4 A T 15: 92,770,067 D700V possibly damaging Het
Pif1 C A 9: 65,588,348 P180Q probably benign Het
Pkig G T 2: 163,721,163 E5* probably null Het
Pla2r1 T A 2: 60,535,002 M75L probably damaging Het
Pllp T C 8: 94,676,243 S157G probably damaging Het
Ppfia1 A T 7: 144,508,210 H566Q probably benign Het
Ptpn13 A G 5: 103,527,095 D646G probably benign Het
Rab11fip5 T A 6: 85,341,556 T784S probably benign Het
Rad51ap2 T G 12: 11,457,981 S635A probably benign Het
Ranbp17 A T 11: 33,284,114 probably null Het
Rce1 C T 19: 4,625,053 G111D probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rimbp2 C T 5: 128,788,371 V631I probably benign Het
Scai T C 2: 39,125,136 T94A probably damaging Het
Sfmbt1 G A 14: 30,816,811 A796T probably benign Het
Slc6a11 C A 6: 114,245,683 Y546* probably null Het
Slc7a2 T C 8: 40,912,649 S506P probably damaging Het
Synj2 T A 17: 6,029,791 N1098K possibly damaging Het
Tmem177 G A 1: 119,910,241 A236V probably damaging Het
Togaram1 T A 12: 64,996,975 D1249E probably damaging Het
Trav17 A T 14: 53,806,639 M1L probably damaging Het
Trim25 C A 11: 89,015,737 A433D possibly damaging Het
Trim69 T C 2: 122,168,027 F160S probably benign Het
Trio A T 15: 27,747,913 V1407E probably benign Het
Ttc12 G T 9: 49,471,879 A75E probably benign Het
Uchl4 A T 9: 64,235,731 I165L probably benign Het
Uvrag A T 7: 99,140,913 L13Q unknown Het
Wwc2 G A 8: 47,864,575 R656W not run Het
Other mutations in Trpm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Trpm7 APN 2 126829031 missense possibly damaging 0.82
IGL01084:Trpm7 APN 2 126846072 critical splice donor site probably null
IGL01634:Trpm7 APN 2 126826818 missense probably damaging 1.00
IGL01678:Trpm7 APN 2 126816799 missense probably damaging 0.99
IGL02005:Trpm7 APN 2 126813184 missense probably damaging 0.97
IGL02064:Trpm7 APN 2 126797943 missense probably damaging 1.00
IGL02156:Trpm7 APN 2 126799243 unclassified probably benign
IGL02172:Trpm7 APN 2 126795328 missense possibly damaging 0.94
IGL02334:Trpm7 APN 2 126807362 missense probably benign
IGL02375:Trpm7 APN 2 126825744 missense probably damaging 1.00
IGL02388:Trpm7 APN 2 126819891 missense possibly damaging 0.80
IGL02552:Trpm7 APN 2 126840779 missense probably damaging 1.00
IGL02684:Trpm7 APN 2 126846159 missense probably damaging 0.99
IGL02901:Trpm7 APN 2 126807287 critical splice donor site probably null
Accused UTSW 2 126826737 missense probably damaging 0.99
Condemned UTSW 2 126835508 missense probably damaging 1.00
P0037:Trpm7 UTSW 2 126816757 splice site probably benign
R0038:Trpm7 UTSW 2 126795468 missense probably damaging 1.00
R0139:Trpm7 UTSW 2 126812771 missense probably benign
R0165:Trpm7 UTSW 2 126797513 missense probably damaging 0.97
R0511:Trpm7 UTSW 2 126826718 nonsense probably null
R0543:Trpm7 UTSW 2 126848529 missense probably damaging 1.00
R0784:Trpm7 UTSW 2 126846072 critical splice donor site probably null
R0844:Trpm7 UTSW 2 126835508 missense probably damaging 1.00
R0865:Trpm7 UTSW 2 126799239 unclassified probably null
R0919:Trpm7 UTSW 2 126831238 missense probably damaging 1.00
R0972:Trpm7 UTSW 2 126805049 missense probably benign
R1109:Trpm7 UTSW 2 126797793 missense probably benign 0.01
R1118:Trpm7 UTSW 2 126822486 missense possibly damaging 0.63
R1278:Trpm7 UTSW 2 126825454 nonsense probably null
R1527:Trpm7 UTSW 2 126830162 missense probably benign 0.18
R1542:Trpm7 UTSW 2 126822599 nonsense probably null
R1882:Trpm7 UTSW 2 126812777 missense probably benign 0.00
R1951:Trpm7 UTSW 2 126831299 missense probably damaging 1.00
R2011:Trpm7 UTSW 2 126823997 nonsense probably null
R2012:Trpm7 UTSW 2 126823997 nonsense probably null
R2026:Trpm7 UTSW 2 126812738 missense probably benign 0.39
R2067:Trpm7 UTSW 2 126797727 missense probably damaging 1.00
R2926:Trpm7 UTSW 2 126858409 splice site probably benign
R3082:Trpm7 UTSW 2 126844422 missense possibly damaging 0.90
R3552:Trpm7 UTSW 2 126826710 splice site probably benign
R3607:Trpm7 UTSW 2 126796428 intron probably benign
R3739:Trpm7 UTSW 2 126851521 missense probably damaging 1.00
R3943:Trpm7 UTSW 2 126831218 missense possibly damaging 0.94
R4161:Trpm7 UTSW 2 126816831 missense probably damaging 1.00
R4176:Trpm7 UTSW 2 126829163 missense possibly damaging 0.83
R4392:Trpm7 UTSW 2 126795509 splice site probably null
R4392:Trpm7 UTSW 2 126848538 missense probably damaging 1.00
R4404:Trpm7 UTSW 2 126833715 missense probably damaging 0.97
R4574:Trpm7 UTSW 2 126797211 missense probably benign 0.01
R4714:Trpm7 UTSW 2 126840783 nonsense probably null
R4807:Trpm7 UTSW 2 126831229 missense probably benign 0.00
R4815:Trpm7 UTSW 2 126858492 missense probably damaging 1.00
R4846:Trpm7 UTSW 2 126813185 missense possibly damaging 0.63
R4972:Trpm7 UTSW 2 126824058 missense probably damaging 1.00
R5097:Trpm7 UTSW 2 126796336 critical splice donor site probably null
R5263:Trpm7 UTSW 2 126821217 missense probably benign 0.34
R5361:Trpm7 UTSW 2 126829241 missense possibly damaging 0.77
R5377:Trpm7 UTSW 2 126842855 critical splice donor site probably null
R5574:Trpm7 UTSW 2 126813030 missense probably benign
R5782:Trpm7 UTSW 2 126797714 missense probably benign 0.04
R5840:Trpm7 UTSW 2 126822611 nonsense probably null
R6044:Trpm7 UTSW 2 126814745 missense probably damaging 1.00
R6178:Trpm7 UTSW 2 126837381 missense probably damaging 1.00
R6196:Trpm7 UTSW 2 126825639 missense possibly damaging 0.66
R6457:Trpm7 UTSW 2 126807294 missense probably benign
R6530:Trpm7 UTSW 2 126812711 missense probably damaging 1.00
R6764:Trpm7 UTSW 2 126844420 missense possibly damaging 0.79
R6841:Trpm7 UTSW 2 126813021 missense probably benign 0.00
R6868:Trpm7 UTSW 2 126837414 missense probably damaging 1.00
R7250:Trpm7 UTSW 2 126826765 missense possibly damaging 0.87
R7402:Trpm7 UTSW 2 126799206 missense probably damaging 1.00
R7486:Trpm7 UTSW 2 126831195 critical splice donor site probably null
R7509:Trpm7 UTSW 2 126849922 missense probably damaging 1.00
R7586:Trpm7 UTSW 2 126810165 missense probably benign
R7774:Trpm7 UTSW 2 126813238 missense probably benign 0.09
R7793:Trpm7 UTSW 2 126824075 nonsense probably null
R7812:Trpm7 UTSW 2 126799316 missense probably damaging 1.00
R7900:Trpm7 UTSW 2 126797498 missense probably benign 0.01
R7983:Trpm7 UTSW 2 126797498 missense probably benign 0.01
X0026:Trpm7 UTSW 2 126829290 missense probably benign
Z1088:Trpm7 UTSW 2 126797281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAAACTCTACAGGGCTAATTGGAG -3'
(R):5'- TCCTTCAGACAGGATGAAACG -3'

Sequencing Primer
(F):5'- ACGTAGAGAAGAGTATACATTATCCC -3'
(R):5'- GAAACGATGGCTATGAAATTACTCAC -3'
Posted On2019-10-07