Mutagenetix > Incidental Mutation

Incidental Mutation 'R0629:Egfr'

57770

Institutional Source

Beutler Lab

Gene Symbol

Egfr

Ensembl Gene

ENSMUSG00000020122

Gene Name

epidermal growth factor receptor

Synonyms

avian erythroblastic leukemia viral (v-erb-b) oncogene homolog, Wa5, 9030024J15Rik, Erbb, Errb1

MMRRC Submission

038818-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.938) question?

Stock #

R0629 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16752203-16918158 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 16869333 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 288 (G288S)

Ref Sequence

ENSEMBL: ENSMUSP00000099948 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020329] [ENSMUST00000102884]

AlphaFold

Q01279

Predicted Effect

probably damaging
Transcript: ENSMUST00000020329
AA Change: G288S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020329
Gene: ENSMUSG00000020122
AA Change: G288S

Domain	Start	End	E-Value	Type
low complexity region	5	25	N/A	INTRINSIC
Pfam:Recep_L_domain	57	168	1.4e-32	PFAM
low complexity region	182	195	N/A	INTRINSIC
FU	228	270	6.07e-4	SMART
Pfam:Recep_L_domain	361	481	1.8e-29	PFAM
FU	496	547	8.25e-6	SMART
FU	552	601	4.38e-10	SMART
FU	614	654	4.05e1	SMART
low complexity region	677	694	N/A	INTRINSIC
TyrKc	714	970	2.88e-129	SMART
low complexity region	1004	1017	N/A	INTRINSIC
low complexity region	1027	1048	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102884
AA Change: G288S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099948
Gene: ENSMUSG00000020122
AA Change: G288S

Domain	Start	End	E-Value	Type
low complexity region	5	25	N/A	INTRINSIC
Pfam:Recep_L_domain	57	168	5e-33	PFAM
low complexity region	182	195	N/A	INTRINSIC
FU	228	270	6.07e-4	SMART
Pfam:Recep_L_domain	361	481	2e-29	PFAM
FU	496	547	8.25e-6	SMART
FU	552	601	4.38e-10	SMART
FU	614	654	4.54e0	SMART

Meta Mutation Damage Score

0.9703

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane glycoprotein that is a member of the protein kinase superfamily. This protein is a receptor for members of the epidermal growth factor family. EGFR is a cell surface protein that binds to epidermal growth factor. Binding of the protein to a ligand induces receptor dimerization and tyrosine autophosphorylation and leads to cell proliferation. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mutations widely affect epithelial development. Null homozygote survival is strain dependent, with defects observed in skin, eye, brain, viscera, palate, tongue and other tisses. Other mutations produce an open eyed, curly whisker phenotype, while a dominant hypermorph yields a thickened epidermis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	T	17: 45,507,547	D86V	probably damaging	Het
Adamts14	G	A	10: 61,211,624	Q733*	probably null	Het
Adcy10	A	G	1: 165,543,105	D651G	probably damaging	Het
Apcdd1	T	A	18: 62,933,970	C52S	probably damaging	Het
Bclaf1	T	C	10: 20,333,426	S463P	probably damaging	Het
Cabcoco1	T	C	10: 68,516,278	Y68C	probably damaging	Het
Cacna1f	G	A	X: 7,620,434	S888N	probably damaging	Het
Cacna1g	A	G	11: 94,409,543	C2134R	possibly damaging	Het
Cdc37	A	C	9: 21,140,768	M325R	possibly damaging	Het
Clca2	T	A	3: 145,072,239	M762L	probably benign	Het
Cntn3	C	T	6: 102,203,976	V753M	probably damaging	Het
Col6a6	A	T	9: 105,727,165		probably benign	Het
Dscaml1	A	G	9: 45,721,418	D1194G	probably damaging	Het
Fbxl17	G	T	17: 63,471,414	N19K	probably damaging	Het
Fmo3	A	G	1: 162,958,227		probably benign	Het
Frmd6	T	C	12: 70,883,762	Y219H	probably damaging	Het
Fuca1	T	C	4: 135,925,644	V193A	possibly damaging	Het
Gm1141	G	C	X: 71,938,773	R296P	possibly damaging	Het
Gm7461	C	T	8: 4,677,769		noncoding transcript	Het
Gpc5	T	A	14: 115,552,239	N508K	possibly damaging	Het
Iqch	A	T	9: 63,425,382	D1019E	probably benign	Het
Isyna1	A	G	8: 70,594,708	Y27C	probably damaging	Het
Itgb8	T	G	12: 119,202,481	H105P	probably benign	Het
Kbtbd11	C	T	8: 15,027,572	P57L	probably benign	Het
Kcns3	A	C	12: 11,092,558	C47G	probably damaging	Het
Kif21b	A	T	1: 136,172,157		probably null	Het
Lama3	A	T	18: 12,419,245	H418L	possibly damaging	Het
Lrit3	A	G	3: 129,788,302	Y679H	probably damaging	Het
Lrrc19	T	A	4: 94,638,252	D356V	probably damaging	Het
Morc2b	A	G	17: 33,135,807	M997T	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Mtcl1	A	T	17: 66,338,142	S1886T	possibly damaging	Het
Muc20	T	C	16: 32,793,421	T529A	possibly damaging	Het
Myo7a	A	C	7: 98,085,466	L607R	probably damaging	Het
Myom2	T	A	8: 15,069,783	F180I	probably damaging	Het
Myt1l	G	A	12: 29,811,485	E89K	unknown	Het
Nek2	A	G	1: 191,831,317	N431S	probably benign	Het
Olfr1086	T	A	2: 86,676,529	H268L	possibly damaging	Het
Olfr169	A	T	16: 19,565,980	V301E	possibly damaging	Het
Oprm1	A	T	10: 6,832,604		probably null	Het
Oxsr1	A	G	9: 119,241,784		probably benign	Het
Pdgfrb	G	A	18: 61,078,648		probably null	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Ptgs2	A	G	1: 150,101,037	Q7R	probably benign	Het
Rab3d	A	G	9: 21,914,686	V144A	probably benign	Het
Ralgapb	T	A	2: 158,439,547	L167H	probably damaging	Het
Ranbp3	A	G	17: 56,708,200	T301A	possibly damaging	Het
Rasgrf1	G	A	9: 89,984,269	V587M	probably damaging	Het
Sec16b	A	G	1: 157,564,863		probably benign	Het
Sin3b	T	C	8: 72,753,536		probably benign	Het
Slc10a2	T	C	8: 5,098,562	S128G	probably benign	Het
Tbl1xr1	G	A	3: 22,210,401	V507I	probably benign	Het
Tmem8b	T	G	4: 43,669,896		probably null	Het
Trak1	A	T	9: 121,367,167	T22S	probably benign	Het
Trim30d	A	G	7: 104,487,655	I114T	probably damaging	Het
Ttc13	A	T	8: 124,674,366	S624T	probably damaging	Het
Ttn	T	C	2: 76,828,130		probably benign	Het
Vipr1	T	A	9: 121,660,171	Y99*	probably null	Het
Vmn1r210	T	C	13: 22,827,874	K81E	probably damaging	Het
Wwc1	T	C	11: 35,853,472	Y841C	probably benign	Het
Xrcc4	A	G	13: 90,000,905		probably benign	Het
Zdhhc22	A	T	12: 86,988,297	I127N	probably damaging	Het
Zdhhc7	A	G	8: 120,088,046	L8P	possibly damaging	Het
Zfp664	C	A	5: 124,885,595	L18I	probably damaging	Het

Other mutations in Egfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Egfr	APN	11	16863020	missense	probably damaging	1.00
IGL01529:Egfr	APN	11	16863014	missense	probably benign
IGL01556:Egfr	APN	11	16905382	missense	probably damaging	1.00
IGL02627:Egfr	APN	11	16869346	missense	probably damaging	1.00
IGL02862:Egfr	APN	11	16883562	missense	probably benign	0.25
IGL02945:Egfr	APN	11	16752514	missense	probably damaging	1.00
IGL02994:Egfr	APN	11	16911811	missense	probably damaging	1.00
IGL03395:Egfr	APN	11	16910261	splice site	probably benign
set	UTSW	11	16871881	splice site	probably benign
Velvet	UTSW	11	16904399	missense	probably damaging	1.00
PIT1430001:Egfr	UTSW	11	16910214	missense	probably benign	0.00
R0196:Egfr	UTSW	11	16911746	missense	probably benign	0.02
R0513:Egfr	UTSW	11	16872855	missense	probably damaging	1.00
R0567:Egfr	UTSW	11	16872873	missense	probably benign	0.01
R0961:Egfr	UTSW	11	16862964	missense	probably damaging	1.00
R1163:Egfr	UTSW	11	16883546	missense	probably benign	0.02
R1454:Egfr	UTSW	11	16889920	missense	probably benign
R1456:Egfr	UTSW	11	16863065	missense	probably benign	0.00
R1503:Egfr	UTSW	11	16869301	missense	possibly damaging	0.86
R1577:Egfr	UTSW	11	16869241	missense	probably benign	0.04
R1595:Egfr	UTSW	11	16906847	missense	probably damaging	0.99
R1699:Egfr	UTSW	11	16859019	missense	probably benign	0.14
R2172:Egfr	UTSW	11	16911562	missense	probably benign	0.00
R3690:Egfr	UTSW	11	16871881	splice site	probably benign
R3922:Egfr	UTSW	11	16881495	missense	probably damaging	1.00
R4444:Egfr	UTSW	11	16871027	missense	probably benign	0.00
R4685:Egfr	UTSW	11	16858980	missense	probably damaging	1.00
R4737:Egfr	UTSW	11	16869231	missense	probably damaging	0.99
R4814:Egfr	UTSW	11	16869354	missense	probably damaging	1.00
R4841:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4842:Egfr	UTSW	11	16911607	missense	probably benign	0.05
R4903:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4964:Egfr	UTSW	11	16908949	missense	probably damaging	1.00
R4985:Egfr	UTSW	11	16859029	nonsense	probably null
R4998:Egfr	UTSW	11	16881493	missense	possibly damaging	0.58
R5001:Egfr	UTSW	11	16904434	missense	probably damaging	0.98
R5304:Egfr	UTSW	11	16884260	missense	probably benign
R5309:Egfr	UTSW	11	16911703	missense	probably benign	0.00
R5653:Egfr	UTSW	11	16911617	missense	probably benign	0.04
R5905:Egfr	UTSW	11	16911494	missense	probably damaging	1.00
R6051:Egfr	UTSW	11	16883607	missense	possibly damaging	0.87
R6052:Egfr	UTSW	11	16911554	missense	probably benign	0.16
R6114:Egfr	UTSW	11	16904374	missense	possibly damaging	0.46
R6261:Egfr	UTSW	11	16889964	missense	probably benign	0.11
R6434:Egfr	UTSW	11	16869294	missense	probably benign	0.25
R6475:Egfr	UTSW	11	16891259	missense	probably benign
R6799:Egfr	UTSW	11	16896952	missense	probably damaging	1.00
R7143:Egfr	UTSW	11	16871627	missense	probably benign	0.20
R7195:Egfr	UTSW	11	16868162	missense	probably damaging	1.00
R7459:Egfr	UTSW	11	16896967	missense	probably damaging	1.00
R7612:Egfr	UTSW	11	16859025	missense	possibly damaging	0.74
R7757:Egfr	UTSW	11	16889966	missense	possibly damaging	0.64
R7763:Egfr	UTSW	11	16891266	missense	probably damaging	1.00
R8315:Egfr	UTSW	11	16875027	missense	probably benign	0.08
R8320:Egfr	UTSW	11	16891251	missense	probably damaging	1.00
R8324:Egfr	UTSW	11	16858971	missense	probably damaging	0.99
R8324:Egfr	UTSW	11	16908885	missense	probably damaging	0.98
R8347:Egfr	UTSW	11	16878174	missense	probably damaging	1.00
R8440:Egfr	UTSW	11	16909831	missense	probably damaging	1.00
R8511:Egfr	UTSW	11	16896949	missense	probably damaging	1.00
R8708:Egfr	UTSW	11	16867300	critical splice donor site	probably benign
R8804:Egfr	UTSW	11	16869339	missense	probably benign	0.09
R8853:Egfr	UTSW	11	16908885	missense	possibly damaging	0.93
R8906:Egfr	UTSW	11	16911635	missense	probably damaging	1.00
R9177:Egfr	UTSW	11	16905410	missense	probably damaging	1.00
R9268:Egfr	UTSW	11	16905410	missense	probably damaging	1.00
R9335:Egfr	UTSW	11	16870991	missense	probably damaging	1.00
R9417:Egfr	UTSW	11	16875067	nonsense	probably null
R9454:Egfr	UTSW	11	16887155	missense	probably damaging	1.00
Z1177:Egfr	UTSW	11	16862954	missense	probably benign	0.05
Z1177:Egfr	UTSW	11	16869319	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAAACTGTCACTGTCCCACTGACC -3'
(R):5'- AAAGGAAGGCATCCTGACTGCTG -3'

Sequencing Primer
(F):5'- CTGGCACTGGGTTCCTTTC -3'
(R):5'- CAGCACTGAGTGGGGTTCTC -3'

Posted On

2013-07-11