Incidental Mutation 'R7451:Eif2b3'
ID 577704
Institutional Source Beutler Lab
Gene Symbol Eif2b3
Ensembl Gene ENSMUSG00000028683
Gene Name eukaryotic translation initiation factor 2B, subunit 3
Synonyms 1190002P15Rik
MMRRC Submission 045525-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7451 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 116876559-116944049 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 116909993 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 176 (L176*)
Ref Sequence ENSEMBL: ENSMUSP00000102055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070610] [ENSMUST00000106447] [ENSMUST00000106448]
AlphaFold B1AUN2
Predicted Effect probably null
Transcript: ENSMUST00000070610
AA Change: L176*
SMART Domains Protein: ENSMUSP00000070334
Gene: ENSMUSG00000028683
AA Change: L176*

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 139 8.2e-20 PFAM
Pfam:NTP_transf_3 5 226 8.5e-19 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106447
AA Change: L176*
SMART Domains Protein: ENSMUSP00000102055
Gene: ENSMUSG00000028683
AA Change: L176*

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 139 1.1e-19 PFAM
Pfam:NTP_transf_3 5 221 1.7e-18 PFAM
low complexity region 247 262 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106448
AA Change: L176*
SMART Domains Protein: ENSMUSP00000102056
Gene: ENSMUSG00000028683
AA Change: L176*

DomainStartEndE-ValueType
Pfam:NTP_transferase 4 140 3.2e-19 PFAM
Pfam:NTP_transf_3 5 237 3.7e-18 PFAM
low complexity region 247 262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the subunits of initiation factor eIF2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. It has also been found to function as a cofactor of hepatitis C virus internal ribosome entry site-mediated translation. Mutations in this gene have been associated with leukodystrophy with vanishing white matter. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,148,797 (GRCm39) I794T probably damaging Het
Abcc5 T A 16: 20,193,820 (GRCm39) H767L probably damaging Het
Adgrb2 A T 4: 129,908,350 (GRCm39) M1031L probably damaging Het
Akna T A 4: 63,296,904 (GRCm39) M891L probably benign Het
Aloxe3 C A 11: 69,033,746 (GRCm39) T620K possibly damaging Het
Amph A G 13: 19,261,538 (GRCm39) Y63C probably damaging Het
Asprv1 A G 6: 86,605,930 (GRCm39) I259V probably benign Het
Atp7b C T 8: 22,504,700 (GRCm39) W652* probably null Het
Atp8a2 C T 14: 60,028,630 (GRCm39) D946N probably null Het
BC024063 T A 10: 81,944,576 (GRCm39) N65K probably benign Het
Bean1 A T 8: 104,940,628 (GRCm39) M154L probably benign Het
Bltp1 G T 3: 37,076,956 (GRCm39) probably null Het
Cacna1c C T 6: 118,570,981 (GRCm39) V2181M unknown Het
Cacna1g A G 11: 94,319,901 (GRCm39) I1425T probably damaging Het
Caskin2 A G 11: 115,702,981 (GRCm39) probably benign Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Cfap97d1 A T 11: 101,882,283 (GRCm39) N147I possibly damaging Het
Cfd T A 10: 79,727,362 (GRCm39) V43E probably damaging Het
Chd9 GCCCC GCCC 8: 91,760,418 (GRCm39) probably null Het
Chd9 T A 8: 91,760,446 (GRCm39) S2064T probably benign Het
Cpsf2 T G 12: 101,967,051 (GRCm39) V646G possibly damaging Het
Ctif T C 18: 75,652,874 (GRCm39) D461G possibly damaging Het
Cyp3a41a T A 5: 145,636,550 (GRCm39) E414D probably benign Het
Dagla A G 19: 10,230,719 (GRCm39) V544A probably damaging Het
Dhx57 A T 17: 80,554,542 (GRCm39) V1228E probably damaging Het
Fbxw26 T A 9: 109,561,691 (GRCm39) I168L probably benign Het
Flt3 T A 5: 147,286,477 (GRCm39) Y703F probably damaging Het
Frmpd1 C T 4: 45,279,558 (GRCm39) P761L probably benign Het
Gabrd A G 4: 155,472,916 (GRCm39) V89A possibly damaging Het
Galnt14 A T 17: 73,881,804 (GRCm39) H98Q probably benign Het
Gli3 T C 13: 15,900,876 (GRCm39) V1421A possibly damaging Het
Gprin2 A G 14: 33,917,762 (GRCm39) S3P probably damaging Het
Ifi211 T G 1: 173,727,058 (GRCm39) D362A probably damaging Het
Lars1 G T 18: 42,335,615 (GRCm39) T1167K probably benign Het
Lce1b T C 3: 92,563,207 (GRCm39) S109G unknown Het
Lrp2 T G 2: 69,343,677 (GRCm39) E894A probably damaging Het
Mamdc4 A G 2: 25,454,473 (GRCm39) V1081A possibly damaging Het
Mcub T C 3: 129,710,752 (GRCm39) S227G possibly damaging Het
Mki67 A G 7: 135,301,080 (GRCm39) I1318T probably benign Het
Mybl2 C T 2: 162,914,626 (GRCm39) T248I possibly damaging Het
Myo9b A T 8: 71,804,832 (GRCm39) H1441L probably benign Het
Nav2 T A 7: 49,202,577 (GRCm39) probably null Het
Neb C T 2: 52,091,466 (GRCm39) V5339I probably benign Het
Nktr T A 9: 121,558,722 (GRCm39) S88T probably damaging Het
Nup155 C T 15: 8,175,091 (GRCm39) Q963* probably null Het
Oas1c A C 5: 120,940,207 (GRCm39) L320V possibly damaging Het
Or10ak14 C T 4: 118,610,884 (GRCm39) A286T probably benign Het
Or10d1b G A 9: 39,613,423 (GRCm39) T214I probably damaging Het
Or1o11 C A 17: 37,757,196 (GRCm39) S261R probably damaging Het
Or2t46 A G 11: 58,472,516 (GRCm39) Y282C probably damaging Het
Or4a81 A G 2: 89,619,453 (GRCm39) M81T probably benign Het
Or52b4i T C 7: 102,191,461 (GRCm39) I106T probably benign Het
Pcdhga7 A G 18: 37,849,057 (GRCm39) S355G possibly damaging Het
Pde11a C T 2: 75,853,117 (GRCm39) V834I possibly damaging Het
Pdzrn4 A T 15: 92,667,948 (GRCm39) D700V possibly damaging Het
Pif1 C A 9: 65,495,630 (GRCm39) P180Q probably benign Het
Pkig G T 2: 163,563,083 (GRCm39) E5* probably null Het
Pla2r1 T A 2: 60,365,346 (GRCm39) M75L probably damaging Het
Pllp T C 8: 95,402,871 (GRCm39) S157G probably damaging Het
Ppfia1 A T 7: 144,061,947 (GRCm39) H566Q probably benign Het
Ptpn13 A G 5: 103,674,961 (GRCm39) D646G probably benign Het
Rab11fip5 T A 6: 85,318,538 (GRCm39) T784S probably benign Het
Rad51ap2 T G 12: 11,507,982 (GRCm39) S635A probably benign Het
Ranbp17 A T 11: 33,234,114 (GRCm39) probably null Het
Rce1 C T 19: 4,675,081 (GRCm39) G111D probably damaging Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rhox4d G A X: 36,700,645 (GRCm39) G191E unknown Het
Rimbp2 C T 5: 128,865,435 (GRCm39) V631I probably benign Het
Scai T C 2: 39,015,148 (GRCm39) T94A probably damaging Het
Sfmbt1 G A 14: 30,538,768 (GRCm39) A796T probably benign Het
Slc6a11 C A 6: 114,222,644 (GRCm39) Y546* probably null Het
Slc7a2 T C 8: 41,365,686 (GRCm39) S506P probably damaging Het
Synj2 T A 17: 6,080,066 (GRCm39) N1098K possibly damaging Het
Tmem177 G A 1: 119,837,971 (GRCm39) A236V probably damaging Het
Togaram1 T A 12: 65,043,749 (GRCm39) D1249E probably damaging Het
Trav17 A T 14: 54,044,096 (GRCm39) M1L probably damaging Het
Trim25 C A 11: 88,906,563 (GRCm39) A433D possibly damaging Het
Trim69 T C 2: 121,998,508 (GRCm39) F160S probably benign Het
Trio A T 15: 27,747,999 (GRCm39) V1407E probably benign Het
Trpm7 A T 2: 126,668,657 (GRCm39) M753K probably damaging Het
Ttc12 G T 9: 49,383,179 (GRCm39) A75E probably benign Het
Uchl4 A T 9: 64,143,013 (GRCm39) I165L probably benign Het
Uvrag A T 7: 98,790,120 (GRCm39) L13Q unknown Het
Wwc2 G A 8: 48,317,610 (GRCm39) R656W not run Het
Other mutations in Eif2b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Eif2b3 APN 4 116,923,666 (GRCm39) missense probably benign
IGL01333:Eif2b3 APN 4 116,927,887 (GRCm39) missense probably benign 0.31
IGL01564:Eif2b3 APN 4 116,885,739 (GRCm39) missense probably benign 0.00
IGL01721:Eif2b3 APN 4 116,916,001 (GRCm39) missense probably damaging 1.00
IGL02061:Eif2b3 APN 4 116,885,608 (GRCm39) missense possibly damaging 0.78
Cambio UTSW 4 116,923,578 (GRCm39) nonsense probably null
mogrify UTSW 4 116,885,622 (GRCm39) missense possibly damaging 0.66
R0835:Eif2b3 UTSW 4 116,916,002 (GRCm39) missense probably damaging 1.00
R0924:Eif2b3 UTSW 4 116,938,775 (GRCm39) missense possibly damaging 0.93
R2167:Eif2b3 UTSW 4 116,885,737 (GRCm39) missense probably damaging 1.00
R2424:Eif2b3 UTSW 4 116,928,045 (GRCm39) missense probably benign 0.01
R3902:Eif2b3 UTSW 4 116,879,404 (GRCm39) missense probably damaging 1.00
R4105:Eif2b3 UTSW 4 116,938,831 (GRCm39) missense probably damaging 1.00
R4688:Eif2b3 UTSW 4 116,916,046 (GRCm39) missense probably benign 0.03
R4998:Eif2b3 UTSW 4 116,923,589 (GRCm39) missense probably benign 0.06
R5033:Eif2b3 UTSW 4 116,909,933 (GRCm39) missense probably damaging 1.00
R5123:Eif2b3 UTSW 4 116,879,408 (GRCm39) missense probably damaging 1.00
R5493:Eif2b3 UTSW 4 116,943,919 (GRCm39) missense possibly damaging 0.92
R5787:Eif2b3 UTSW 4 116,901,637 (GRCm39) missense probably damaging 1.00
R5789:Eif2b3 UTSW 4 116,885,692 (GRCm39) missense probably damaging 1.00
R6347:Eif2b3 UTSW 4 116,901,763 (GRCm39) missense probably benign 0.05
R6361:Eif2b3 UTSW 4 116,885,622 (GRCm39) missense possibly damaging 0.66
R6643:Eif2b3 UTSW 4 116,927,954 (GRCm39) missense probably damaging 0.97
R6798:Eif2b3 UTSW 4 116,923,655 (GRCm39) missense probably benign 0.00
R7299:Eif2b3 UTSW 4 116,910,019 (GRCm39) missense probably benign 0.27
R7301:Eif2b3 UTSW 4 116,910,019 (GRCm39) missense probably benign 0.27
R7934:Eif2b3 UTSW 4 116,923,675 (GRCm39) missense probably benign
R8117:Eif2b3 UTSW 4 116,879,414 (GRCm39) missense probably damaging 0.98
R8725:Eif2b3 UTSW 4 116,927,944 (GRCm39) missense probably benign 0.01
R8727:Eif2b3 UTSW 4 116,927,944 (GRCm39) missense probably benign 0.01
R8816:Eif2b3 UTSW 4 116,928,052 (GRCm39) missense probably benign
R8943:Eif2b3 UTSW 4 116,901,778 (GRCm39) missense probably damaging 0.99
R9141:Eif2b3 UTSW 4 116,923,578 (GRCm39) nonsense probably null
R9426:Eif2b3 UTSW 4 116,923,578 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGGCCTACTTGATTCTAAGAGC -3'
(R):5'- GAACACTAAGTGCATGCCGTG -3'

Sequencing Primer
(F):5'- CTCTCTAAGCTCTCTACCCTGTC -3'
(R):5'- CTGTCTCAGGGGATAGCATTCAC -3'
Posted On 2019-10-07