Incidental Mutation 'R7451:Cyp3a41a'
ID577712
Institutional Source Beutler Lab
Gene Symbol Cyp3a41a
Ensembl Gene ENSMUSG00000075551
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 41A
Synonymssteroid inducible, Cyp3a41
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R7451 (G1)
Quality Score81.0075
Status Not validated
Chromosome5
Chromosomal Location145694049-145720136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145699740 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 414 (E414D)
Ref Sequence ENSEMBL: ENSMUSP00000091659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094111]
Predicted Effect probably benign
Transcript: ENSMUST00000094111
AA Change: E414D

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000091659
Gene: ENSMUSG00000075551
AA Change: E414D

DomainStartEndE-ValueType
Pfam:p450 38 494 1.7e-136 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,457 N147I possibly damaging Het
Abcb6 A G 1: 75,172,153 I794T probably damaging Het
Abcc5 T A 16: 20,375,070 H767L probably damaging Het
Adgrb2 A T 4: 130,014,557 M1031L probably damaging Het
Akna T A 4: 63,378,667 M891L probably benign Het
Aloxe3 C A 11: 69,142,920 T620K possibly damaging Het
Amph A G 13: 19,077,368 Y63C probably damaging Het
Asprv1 A G 6: 86,628,948 I259V probably benign Het
Atp7b C T 8: 22,014,684 W652* probably null Het
Atp8a2 C T 14: 59,791,181 D946N probably null Het
BC024063 T A 10: 82,108,742 N65K probably benign Het
Bean1 A T 8: 104,213,996 M154L probably benign Het
Cacna1c C T 6: 118,594,020 V2181M unknown Het
Cacna1g A G 11: 94,429,075 I1425T probably damaging Het
Caskin2 A G 11: 115,812,155 probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfd T A 10: 79,891,528 V43E probably damaging Het
Chd9 GCCCC GCCC 8: 91,033,790 probably null Het
Chd9 T A 8: 91,033,818 S2064T probably benign Het
Cpsf2 T G 12: 102,000,792 V646G possibly damaging Het
Ctif T C 18: 75,519,803 D461G possibly damaging Het
Dagla A G 19: 10,253,355 V544A probably damaging Het
Dhx57 A T 17: 80,247,113 V1228E probably damaging Het
Eif2b3 T A 4: 117,052,796 L176* probably null Het
Fbxw26 T A 9: 109,732,623 I168L probably benign Het
Flt3 T A 5: 147,349,667 Y703F probably damaging Het
Frmpd1 C T 4: 45,279,558 P761L probably benign Het
Gabrd A G 4: 155,388,459 V89A possibly damaging Het
Galnt14 A T 17: 73,574,809 H98Q probably benign Het
Gli3 T C 13: 15,726,291 V1421A possibly damaging Het
Gprin2 A G 14: 34,195,805 S3P probably damaging Het
Ifi211 T G 1: 173,899,492 D362A probably damaging Het
Lars G T 18: 42,202,550 T1167K probably benign Het
Lce1b T C 3: 92,655,900 S109G unknown Het
Lrp2 T G 2: 69,513,333 E894A probably damaging Het
Mamdc4 A G 2: 25,564,461 V1081A possibly damaging Het
Mcub T C 3: 129,917,103 S227G possibly damaging Het
Mki67 A G 7: 135,699,351 I1318T probably benign Het
Mybl2 C T 2: 163,072,706 T248I possibly damaging Het
Myo9b A T 8: 71,352,188 H1441L probably benign Het
Neb C T 2: 52,201,454 V5339I probably benign Het
Nktr T A 9: 121,729,656 S88T probably damaging Het
Nup155 C T 15: 8,145,607 Q963* probably null Het
Oas1c A C 5: 120,802,142 L320V possibly damaging Het
Olfr108 C A 17: 37,446,305 S261R probably damaging Het
Olfr1254 A G 2: 89,789,109 M81T probably benign Het
Olfr1338 C T 4: 118,753,687 A286T probably benign Het
Olfr149 G A 9: 39,702,127 T214I probably damaging Het
Olfr325 A G 11: 58,581,690 Y282C probably damaging Het
Olfr548-ps1 T C 7: 102,542,254 I106T probably benign Het
Pcdhga7 A G 18: 37,716,004 S355G possibly damaging Het
Pde11a C T 2: 76,022,773 V834I possibly damaging Het
Pdzrn4 A T 15: 92,770,067 D700V possibly damaging Het
Pif1 C A 9: 65,588,348 P180Q probably benign Het
Pkig G T 2: 163,721,163 E5* probably null Het
Pla2r1 T A 2: 60,535,002 M75L probably damaging Het
Pllp T C 8: 94,676,243 S157G probably damaging Het
Ppfia1 A T 7: 144,508,210 H566Q probably benign Het
Ptpn13 A G 5: 103,527,095 D646G probably benign Het
Rab11fip5 T A 6: 85,341,556 T784S probably benign Het
Rad51ap2 T G 12: 11,457,981 S635A probably benign Het
Rce1 C T 19: 4,625,053 G111D probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rimbp2 C T 5: 128,788,371 V631I probably benign Het
Scai T C 2: 39,125,136 T94A probably damaging Het
Sfmbt1 G A 14: 30,816,811 A796T probably benign Het
Slc6a11 C A 6: 114,245,683 Y546* probably null Het
Slc7a2 T C 8: 40,912,649 S506P probably damaging Het
Synj2 T A 17: 6,029,791 N1098K possibly damaging Het
Tmem177 G A 1: 119,910,241 A236V probably damaging Het
Togaram1 T A 12: 64,996,975 D1249E probably damaging Het
Trav17 A T 14: 53,806,639 M1L probably damaging Het
Trim25 C A 11: 89,015,737 A433D possibly damaging Het
Trim69 T C 2: 122,168,027 F160S probably benign Het
Trio A T 15: 27,747,913 V1407E probably benign Het
Trpm7 A T 2: 126,826,737 M753K probably damaging Het
Ttc12 G T 9: 49,471,879 A75E probably benign Het
Uchl4 A T 9: 64,235,731 I165L probably benign Het
Uvrag A T 7: 99,140,913 L13Q unknown Het
Wwc2 G A 8: 47,864,575 R656W not run Het
Other mutations in Cyp3a41a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02284:Cyp3a41a APN 5 145704863 splice site probably benign
IGL03003:Cyp3a41a APN 5 145705830 missense probably benign
R0006:Cyp3a41a UTSW 5 145704796 missense probably benign 0.01
R0515:Cyp3a41a UTSW 5 145718000 missense probably damaging 1.00
R1052:Cyp3a41a UTSW 5 145705811 missense possibly damaging 0.49
R3708:Cyp3a41a UTSW 5 145717923 critical splice donor site probably null
R4049:Cyp3a41a UTSW 5 145713540 missense probably damaging 1.00
R4755:Cyp3a41a UTSW 5 145715506 missense probably damaging 1.00
R4975:Cyp3a41a UTSW 5 145720048 start codon destroyed probably null 1.00
R6519:Cyp3a41a UTSW 5 145715498 missense probably damaging 1.00
R6788:Cyp3a41a UTSW 5 145705829 missense probably benign 0.00
R7184:Cyp3a41a UTSW 5 145705853 missense probably benign 0.01
R7372:Cyp3a41a UTSW 5 145713564 missense possibly damaging 0.67
R7463:Cyp3a41a UTSW 5 145713564 missense probably damaging 1.00
R7766:Cyp3a41a UTSW 5 145718017 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTTAGACTTTATGCCAGTCGC -3'
(R):5'- TCCCACCTATGATACTGTGATGGAG -3'

Sequencing Primer
(F):5'- TGCCAGTCGCACTTCCC -3'
(R):5'- ATGGAATACCTGGATATGGTGC -3'
Posted On2019-10-07