Mutagenetix > Incidental Mutations

Incidental Mutation 'R7451:Slc7a2'

577723

Institutional Source

Beutler Lab

Gene Symbol

Slc7a2

Ensembl Gene

ENSMUSG00000031596

Gene Name

solute carrier family 7 (cationic amino acid transporter, y+ system), member 2

Synonyms

Tea, Cat2, Atrc2

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7451 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

40862396-40922308 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40912649 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 506 (S506P)

Ref Sequence

ENSEMBL: ENSMUSP00000112848 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057784] [ENSMUST00000098816] [ENSMUST00000117077] [ENSMUST00000118432]

Predicted Effect

probably damaging
Transcript: ENSMUST00000057784
AA Change: S489P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000058866
Gene: ENSMUSG00000031596
AA Change: S489P

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	34	450	1.4e-55	PFAM
Pfam:AA_permease	38	442	9.7e-38	PFAM
transmembrane domain	492	514	N/A	INTRINSIC
transmembrane domain	524	543	N/A	INTRINSIC
Pfam:AA_permease_C	555	605	4.2e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000098816
AA Change: S490P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000096414
Gene: ENSMUSG00000031596
AA Change: S490P

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	34	451	8.9e-54	PFAM
Pfam:AA_permease	38	443	5.8e-35	PFAM
transmembrane domain	493	515	N/A	INTRINSIC
transmembrane domain	525	544	N/A	INTRINSIC
Pfam:AA_permease_C	556	606	4.1e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000117077
AA Change: S490P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000113729
Gene: ENSMUSG00000031596
AA Change: S490P

Domain	Start	End	E-Value	Type
Pfam:AA_permease_2	34	454	2e-52	PFAM
Pfam:AA_permease	38	440	4.8e-33	PFAM
transmembrane domain	493	515	N/A	INTRINSIC
transmembrane domain	525	544	N/A	INTRINSIC
Pfam:AA_permease_C	556	606	3e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000118432
AA Change: S506P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112848
Gene: ENSMUSG00000031596
AA Change: S506P

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
Pfam:AA_permease_2	51	469	5.1e-54	PFAM
Pfam:AA_permease	55	456	5.1e-36	PFAM
transmembrane domain	509	531	N/A	INTRINSIC
transmembrane domain	541	560	N/A	INTRINSIC
Pfam:AA_permease_C	572	622	2.5e-28	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cationic amino acid transporter and a member of the APC (amino acid-polyamine-organocation) family of transporters. The encoded membrane protein is responsible for the cellular uptake of arginine, lysine and ornithine. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a marked reduction of nitric oxide production by cytokine-activated macrophages. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	A	T	11: 101,991,457	N147I	possibly damaging	Het
Abcb6	A	G	1: 75,172,153	I794T	probably damaging	Het
Abcc5	T	A	16: 20,375,070	H767L	probably damaging	Het
Adgrb2	A	T	4: 130,014,557	M1031L	probably damaging	Het
Akna	T	A	4: 63,378,667	M891L	probably benign	Het
Aloxe3	C	A	11: 69,142,920	T620K	possibly damaging	Het
Amph	A	G	13: 19,077,368	Y63C	probably damaging	Het
Asprv1	A	G	6: 86,628,948	I259V	probably benign	Het
Atp7b	C	T	8: 22,014,684	W652*	probably null	Het
Atp8a2	C	T	14: 59,791,181	D946N	probably null	Het
BC024063	T	A	10: 82,108,742	N65K	probably benign	Het
Bean1	A	T	8: 104,213,996	M154L	probably benign	Het
Cacna1c	C	T	6: 118,594,020	V2181M	unknown	Het
Cacna1g	A	G	11: 94,429,075	I1425T	probably damaging	Het
Caskin2	A	G	11: 115,812,155		probably benign	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cfd	T	A	10: 79,891,528	V43E	probably damaging	Het
Chd9	GCCCC	GCCC	8: 91,033,790		probably null	Het
Chd9	T	A	8: 91,033,818	S2064T	probably benign	Het
Cpsf2	T	G	12: 102,000,792	V646G	possibly damaging	Het
Ctif	T	C	18: 75,519,803	D461G	possibly damaging	Het
Cyp3a41a	T	A	5: 145,699,740	E414D	probably benign	Het
Dagla	A	G	19: 10,253,355	V544A	probably damaging	Het
Dhx57	A	T	17: 80,247,113	V1228E	probably damaging	Het
Eif2b3	T	A	4: 117,052,796	L176*	probably null	Het
Fbxw26	T	A	9: 109,732,623	I168L	probably benign	Het
Flt3	T	A	5: 147,349,667	Y703F	probably damaging	Het
Frmpd1	C	T	4: 45,279,558	P761L	probably benign	Het
Gabrd	A	G	4: 155,388,459	V89A	possibly damaging	Het
Galnt14	A	T	17: 73,574,809	H98Q	probably benign	Het
Gli3	T	C	13: 15,726,291	V1421A	possibly damaging	Het
Gprin2	A	G	14: 34,195,805	S3P	probably damaging	Het
Ifi211	T	G	1: 173,899,492	D362A	probably damaging	Het
Lars	G	T	18: 42,202,550	T1167K	probably benign	Het
Lce1b	T	C	3: 92,655,900	S109G	unknown	Het
Lrp2	T	G	2: 69,513,333	E894A	probably damaging	Het
Mamdc4	A	G	2: 25,564,461	V1081A	possibly damaging	Het
Mcub	T	C	3: 129,917,103	S227G	possibly damaging	Het
Mki67	A	G	7: 135,699,351	I1318T	probably benign	Het
Mybl2	C	T	2: 163,072,706	T248I	possibly damaging	Het
Myo9b	A	T	8: 71,352,188	H1441L	probably benign	Het
Neb	C	T	2: 52,201,454	V5339I	probably benign	Het
Nktr	T	A	9: 121,729,656	S88T	probably damaging	Het
Nup155	C	T	15: 8,145,607	Q963*	probably null	Het
Oas1c	A	C	5: 120,802,142	L320V	possibly damaging	Het
Olfr108	C	A	17: 37,446,305	S261R	probably damaging	Het
Olfr1254	A	G	2: 89,789,109	M81T	probably benign	Het
Olfr1338	C	T	4: 118,753,687	A286T	probably benign	Het
Olfr149	G	A	9: 39,702,127	T214I	probably damaging	Het
Olfr325	A	G	11: 58,581,690	Y282C	probably damaging	Het
Olfr548-ps1	T	C	7: 102,542,254	I106T	probably benign	Het
Pcdhga7	A	G	18: 37,716,004	S355G	possibly damaging	Het
Pde11a	C	T	2: 76,022,773	V834I	possibly damaging	Het
Pdzrn4	A	T	15: 92,770,067	D700V	possibly damaging	Het
Pif1	C	A	9: 65,588,348	P180Q	probably benign	Het
Pkig	G	T	2: 163,721,163	E5*	probably null	Het
Pla2r1	T	A	2: 60,535,002	M75L	probably damaging	Het
Pllp	T	C	8: 94,676,243	S157G	probably damaging	Het
Ppfia1	A	T	7: 144,508,210	H566Q	probably benign	Het
Ptpn13	A	G	5: 103,527,095	D646G	probably benign	Het
Rab11fip5	T	A	6: 85,341,556	T784S	probably benign	Het
Rad51ap2	T	G	12: 11,457,981	S635A	probably benign	Het
Rce1	C	T	19: 4,625,053	G111D	probably damaging	Het
Rcor3	C	A	1: 192,137,876	G8V	probably damaging	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rimbp2	C	T	5: 128,788,371	V631I	probably benign	Het
Scai	T	C	2: 39,125,136	T94A	probably damaging	Het
Sfmbt1	G	A	14: 30,816,811	A796T	probably benign	Het
Slc6a11	C	A	6: 114,245,683	Y546*	probably null	Het
Synj2	T	A	17: 6,029,791	N1098K	possibly damaging	Het
Tmem177	G	A	1: 119,910,241	A236V	probably damaging	Het
Togaram1	T	A	12: 64,996,975	D1249E	probably damaging	Het
Trav17	A	T	14: 53,806,639	M1L	probably damaging	Het
Trim25	C	A	11: 89,015,737	A433D	possibly damaging	Het
Trim69	T	C	2: 122,168,027	F160S	probably benign	Het
Trio	A	T	15: 27,747,913	V1407E	probably benign	Het
Trpm7	A	T	2: 126,826,737	M753K	probably damaging	Het
Ttc12	G	T	9: 49,471,879	A75E	probably benign	Het
Uchl4	A	T	9: 64,235,731	I165L	probably benign	Het
Uvrag	A	T	7: 99,140,913	L13Q	unknown	Het
Wwc2	G	A	8: 47,864,575	R656W	not run	Het

Other mutations in Slc7a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00662:Slc7a2	APN	8	40905622	missense	possibly damaging	0.57
IGL00948:Slc7a2	APN	8	40912524	missense	probably benign	0.04
IGL01565:Slc7a2	APN	8	40899238	missense	possibly damaging	0.94
IGL01590:Slc7a2	APN	8	40914100	missense	probably damaging	1.00
IGL01939:Slc7a2	APN	8	40914083	missense	possibly damaging	0.93
IGL02043:Slc7a2	APN	8	40911058	missense	probably benign	0.35
IGL02101:Slc7a2	APN	8	40902594	missense	probably benign	0.07
IGL02238:Slc7a2	APN	8	40908156	missense	probably benign
IGL02385:Slc7a2	APN	8	40899011	missense	probably damaging	0.98
IGL02562:Slc7a2	APN	8	40915020	missense	probably damaging	1.00
IGL02962:Slc7a2	APN	8	40905584	missense	probably damaging	0.98
IGL03268:Slc7a2	APN	8	40912517	missense	probably benign	0.00
IGL03285:Slc7a2	APN	8	40914993	missense	possibly damaging	0.50
IGL03345:Slc7a2	APN	8	40916493	missense	probably benign	0.25
IGL03375:Slc7a2	APN	8	40916373	missense	probably damaging	1.00
R0014:Slc7a2	UTSW	8	40911028	missense	probably damaging	1.00
R0014:Slc7a2	UTSW	8	40911028	missense	probably damaging	1.00
R0437:Slc7a2	UTSW	8	40904526	missense	probably damaging	1.00
R0624:Slc7a2	UTSW	8	40908531	missense	probably benign	0.34
R1406:Slc7a2	UTSW	8	40905585	missense	probably damaging	1.00
R1406:Slc7a2	UTSW	8	40905585	missense	probably damaging	1.00
R1908:Slc7a2	UTSW	8	40916497	missense	probably benign
R1959:Slc7a2	UTSW	8	40914965	missense	probably damaging	0.97
R2251:Slc7a2	UTSW	8	40905621	missense	probably benign	0.19
R2252:Slc7a2	UTSW	8	40905621	missense	probably benign	0.19
R2253:Slc7a2	UTSW	8	40905621	missense	probably benign	0.19
R3498:Slc7a2	UTSW	8	40912530	missense	probably benign	0.11
R3899:Slc7a2	UTSW	8	40905553	missense	possibly damaging	0.93
R4440:Slc7a2	UTSW	8	40902649	missense	probably benign
R4785:Slc7a2	UTSW	8	40911058	missense	probably benign	0.18
R4788:Slc7a2	UTSW	8	40913986	missense	probably benign
R4826:Slc7a2	UTSW	8	40911046	missense	probably damaging	1.00
R4996:Slc7a2	UTSW	8	40912562	nonsense	probably null
R5249:Slc7a2	UTSW	8	40908093	missense	possibly damaging	0.77
R5314:Slc7a2	UTSW	8	40915030	critical splice donor site	probably null
R5408:Slc7a2	UTSW	8	40915005	missense	probably damaging	1.00
R5537:Slc7a2	UTSW	8	40913986	missense	probably benign	0.10
R6116:Slc7a2	UTSW	8	40900169	missense	probably damaging	0.98
R7139:Slc7a2	UTSW	8	40915013	missense	probably benign	0.01
R7389:Slc7a2	UTSW	8	40912515	missense	probably benign
X0062:Slc7a2	UTSW	8	40914963	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGTTCATTTTGGGCCAATTCG -3'
(R):5'- TCCCAGTGCCTCTGTAGGTATAAAG -3'

Sequencing Primer
(F):5'- TTGGGCCAATTCGATTAAAGACACC -3'
(R):5'- GCCTCTGTAGGTATAAAGTTCACAGC -3'

Posted On

2019-10-07