Incidental Mutation 'R0629:Kcns3'
ID 57773
Institutional Source Beutler Lab
Gene Symbol Kcns3
Ensembl Gene ENSMUSG00000043673
Gene Name potassium voltage-gated channel, delayed-rectifier, subfamily S, member 3
Synonyms D12Ertd137e
MMRRC Submission 038818-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.143) question?
Stock # R0629 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 11090202-11151056 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 11092558 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 47 (C47G)
Ref Sequence ENSEMBL: ENSMUSP00000152026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055673] [ENSMUST00000164495] [ENSMUST00000217974]
AlphaFold Q8BQZ8
Predicted Effect probably damaging
Transcript: ENSMUST00000055673
AA Change: C47G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000060706
Gene: ENSMUSG00000043673
AA Change: C47G

DomainStartEndE-ValueType
BTB 15 124 1.2e-12 SMART
low complexity region 144 162 N/A INTRINSIC
Pfam:Ion_trans 184 417 5.2e-47 PFAM
Pfam:Ion_trans_2 325 411 3.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164495
AA Change: C47G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129412
Gene: ENSMUSG00000043673
AA Change: C47G

DomainStartEndE-ValueType
BTB 15 124 1.2e-12 SMART
low complexity region 144 162 N/A INTRINSIC
Pfam:Ion_trans 184 417 5.2e-47 PFAM
Pfam:Ion_trans_2 325 411 3.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217974
AA Change: C47G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.7899 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Kcns3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Kcns3 APN 12 11092426 missense probably benign 0.40
IGL01089:Kcns3 APN 12 11091571 missense possibly damaging 0.92
IGL01448:Kcns3 APN 12 11091643 missense possibly damaging 0.91
IGL02084:Kcns3 APN 12 11092194 missense probably damaging 0.96
IGL02229:Kcns3 APN 12 11092092 missense probably damaging 1.00
IGL02730:Kcns3 APN 12 11092075 missense probably benign
IGL02820:Kcns3 APN 12 11091871 missense probably benign 0.01
IGL03390:Kcns3 APN 12 11091232 missense probably benign
PIT4696001:Kcns3 UTSW 12 11092748 start gained probably benign
R0583:Kcns3 UTSW 12 11091478 missense probably damaging 1.00
R1549:Kcns3 UTSW 12 11092083 missense probably damaging 1.00
R1571:Kcns3 UTSW 12 11091550 missense probably damaging 1.00
R1755:Kcns3 UTSW 12 11091444 missense probably benign 0.09
R2507:Kcns3 UTSW 12 11092086 missense possibly damaging 0.67
R4348:Kcns3 UTSW 12 11091381 missense possibly damaging 0.85
R4667:Kcns3 UTSW 12 11091783 missense probably damaging 1.00
R4750:Kcns3 UTSW 12 11091654 missense probably damaging 1.00
R5704:Kcns3 UTSW 12 11092327 missense probably benign 0.05
R5770:Kcns3 UTSW 12 11092249 missense probably benign 0.15
R6882:Kcns3 UTSW 12 11092048 missense probably benign 0.00
R7014:Kcns3 UTSW 12 11091687 missense probably damaging 1.00
R7935:Kcns3 UTSW 12 11091717 missense probably damaging 1.00
R8025:Kcns3 UTSW 12 11091845 missense probably damaging 1.00
R8161:Kcns3 UTSW 12 11119763 start gained probably benign
R8210:Kcns3 UTSW 12 11092252 missense probably damaging 0.97
R8403:Kcns3 UTSW 12 11091653 missense probably benign 0.09
R8726:Kcns3 UTSW 12 11091691 missense probably damaging 1.00
R9175:Kcns3 UTSW 12 11119800 start gained probably benign
R9287:Kcns3 UTSW 12 11091600 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGAGTCTGTGCTCACATCGTTGC -3'
(R):5'- AGTCAGGCCATTCTCCCACAAAGG -3'

Sequencing Primer
(F):5'- CTGCTACAGCAGGAGTCAATG -3'
(R):5'- GCACAGGCTAATATTGTCTTGTC -3'
Posted On 2013-07-11