Incidental Mutation 'R7451:Fbxw26'
ID 577734
Institutional Source Beutler Lab
Gene Symbol Fbxw26
Ensembl Gene ENSMUSG00000059547
Gene Name F-box and WD-40 domain protein 26
Synonyms Gm5163
MMRRC Submission 045525-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7451 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 109546634-109575157 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 109561691 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 168 (I168L)
Ref Sequence ENSEMBL: ENSMUSP00000071811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071917]
AlphaFold Q8BI58
Predicted Effect probably benign
Transcript: ENSMUST00000071917
AA Change: I168L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000071811
Gene: ENSMUSG00000059547
AA Change: I168L

DomainStartEndE-ValueType
FBOX 5 45 2.54e-6 SMART
SCOP:d1tbga_ 128 249 1e-5 SMART
Blast:WD40 137 176 4e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,148,797 (GRCm39) I794T probably damaging Het
Abcc5 T A 16: 20,193,820 (GRCm39) H767L probably damaging Het
Adgrb2 A T 4: 129,908,350 (GRCm39) M1031L probably damaging Het
Akna T A 4: 63,296,904 (GRCm39) M891L probably benign Het
Aloxe3 C A 11: 69,033,746 (GRCm39) T620K possibly damaging Het
Amph A G 13: 19,261,538 (GRCm39) Y63C probably damaging Het
Asprv1 A G 6: 86,605,930 (GRCm39) I259V probably benign Het
Atp7b C T 8: 22,504,700 (GRCm39) W652* probably null Het
Atp8a2 C T 14: 60,028,630 (GRCm39) D946N probably null Het
BC024063 T A 10: 81,944,576 (GRCm39) N65K probably benign Het
Bean1 A T 8: 104,940,628 (GRCm39) M154L probably benign Het
Bltp1 G T 3: 37,076,956 (GRCm39) probably null Het
Cacna1c C T 6: 118,570,981 (GRCm39) V2181M unknown Het
Cacna1g A G 11: 94,319,901 (GRCm39) I1425T probably damaging Het
Caskin2 A G 11: 115,702,981 (GRCm39) probably benign Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Cfap97d1 A T 11: 101,882,283 (GRCm39) N147I possibly damaging Het
Cfd T A 10: 79,727,362 (GRCm39) V43E probably damaging Het
Chd9 GCCCC GCCC 8: 91,760,418 (GRCm39) probably null Het
Chd9 T A 8: 91,760,446 (GRCm39) S2064T probably benign Het
Cpsf2 T G 12: 101,967,051 (GRCm39) V646G possibly damaging Het
Ctif T C 18: 75,652,874 (GRCm39) D461G possibly damaging Het
Cyp3a41a T A 5: 145,636,550 (GRCm39) E414D probably benign Het
Dagla A G 19: 10,230,719 (GRCm39) V544A probably damaging Het
Dhx57 A T 17: 80,554,542 (GRCm39) V1228E probably damaging Het
Eif2b3 T A 4: 116,909,993 (GRCm39) L176* probably null Het
Flt3 T A 5: 147,286,477 (GRCm39) Y703F probably damaging Het
Frmpd1 C T 4: 45,279,558 (GRCm39) P761L probably benign Het
Gabrd A G 4: 155,472,916 (GRCm39) V89A possibly damaging Het
Galnt14 A T 17: 73,881,804 (GRCm39) H98Q probably benign Het
Gli3 T C 13: 15,900,876 (GRCm39) V1421A possibly damaging Het
Gprin2 A G 14: 33,917,762 (GRCm39) S3P probably damaging Het
Ifi211 T G 1: 173,727,058 (GRCm39) D362A probably damaging Het
Lars1 G T 18: 42,335,615 (GRCm39) T1167K probably benign Het
Lce1b T C 3: 92,563,207 (GRCm39) S109G unknown Het
Lrp2 T G 2: 69,343,677 (GRCm39) E894A probably damaging Het
Mamdc4 A G 2: 25,454,473 (GRCm39) V1081A possibly damaging Het
Mcub T C 3: 129,710,752 (GRCm39) S227G possibly damaging Het
Mki67 A G 7: 135,301,080 (GRCm39) I1318T probably benign Het
Mybl2 C T 2: 162,914,626 (GRCm39) T248I possibly damaging Het
Myo9b A T 8: 71,804,832 (GRCm39) H1441L probably benign Het
Nav2 T A 7: 49,202,577 (GRCm39) probably null Het
Neb C T 2: 52,091,466 (GRCm39) V5339I probably benign Het
Nktr T A 9: 121,558,722 (GRCm39) S88T probably damaging Het
Nup155 C T 15: 8,175,091 (GRCm39) Q963* probably null Het
Oas1c A C 5: 120,940,207 (GRCm39) L320V possibly damaging Het
Or10ak14 C T 4: 118,610,884 (GRCm39) A286T probably benign Het
Or10d1b G A 9: 39,613,423 (GRCm39) T214I probably damaging Het
Or1o11 C A 17: 37,757,196 (GRCm39) S261R probably damaging Het
Or2t46 A G 11: 58,472,516 (GRCm39) Y282C probably damaging Het
Or4a81 A G 2: 89,619,453 (GRCm39) M81T probably benign Het
Or52b4i T C 7: 102,191,461 (GRCm39) I106T probably benign Het
Pcdhga7 A G 18: 37,849,057 (GRCm39) S355G possibly damaging Het
Pde11a C T 2: 75,853,117 (GRCm39) V834I possibly damaging Het
Pdzrn4 A T 15: 92,667,948 (GRCm39) D700V possibly damaging Het
Pif1 C A 9: 65,495,630 (GRCm39) P180Q probably benign Het
Pkig G T 2: 163,563,083 (GRCm39) E5* probably null Het
Pla2r1 T A 2: 60,365,346 (GRCm39) M75L probably damaging Het
Pllp T C 8: 95,402,871 (GRCm39) S157G probably damaging Het
Ppfia1 A T 7: 144,061,947 (GRCm39) H566Q probably benign Het
Ptpn13 A G 5: 103,674,961 (GRCm39) D646G probably benign Het
Rab11fip5 T A 6: 85,318,538 (GRCm39) T784S probably benign Het
Rad51ap2 T G 12: 11,507,982 (GRCm39) S635A probably benign Het
Ranbp17 A T 11: 33,234,114 (GRCm39) probably null Het
Rce1 C T 19: 4,675,081 (GRCm39) G111D probably damaging Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rhox4d G A X: 36,700,645 (GRCm39) G191E unknown Het
Rimbp2 C T 5: 128,865,435 (GRCm39) V631I probably benign Het
Scai T C 2: 39,015,148 (GRCm39) T94A probably damaging Het
Sfmbt1 G A 14: 30,538,768 (GRCm39) A796T probably benign Het
Slc6a11 C A 6: 114,222,644 (GRCm39) Y546* probably null Het
Slc7a2 T C 8: 41,365,686 (GRCm39) S506P probably damaging Het
Synj2 T A 17: 6,080,066 (GRCm39) N1098K possibly damaging Het
Tmem177 G A 1: 119,837,971 (GRCm39) A236V probably damaging Het
Togaram1 T A 12: 65,043,749 (GRCm39) D1249E probably damaging Het
Trav17 A T 14: 54,044,096 (GRCm39) M1L probably damaging Het
Trim25 C A 11: 88,906,563 (GRCm39) A433D possibly damaging Het
Trim69 T C 2: 121,998,508 (GRCm39) F160S probably benign Het
Trio A T 15: 27,747,999 (GRCm39) V1407E probably benign Het
Trpm7 A T 2: 126,668,657 (GRCm39) M753K probably damaging Het
Ttc12 G T 9: 49,383,179 (GRCm39) A75E probably benign Het
Uchl4 A T 9: 64,143,013 (GRCm39) I165L probably benign Het
Uvrag A T 7: 98,790,120 (GRCm39) L13Q unknown Het
Wwc2 G A 8: 48,317,610 (GRCm39) R656W not run Het
Other mutations in Fbxw26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Fbxw26 APN 9 109,547,016 (GRCm39) utr 3 prime probably benign
IGL01072:Fbxw26 APN 9 109,552,905 (GRCm39) missense probably damaging 1.00
IGL01151:Fbxw26 APN 9 109,550,848 (GRCm39) missense possibly damaging 0.50
IGL01394:Fbxw26 APN 9 109,547,057 (GRCm39) missense probably benign 0.00
IGL01432:Fbxw26 APN 9 109,547,043 (GRCm39) missense probably benign 0.32
IGL02559:Fbxw26 APN 9 109,551,232 (GRCm39) missense probably benign 0.34
IGL02981:Fbxw26 APN 9 109,573,862 (GRCm39) missense probably benign 0.09
IGL03370:Fbxw26 APN 9 109,575,087 (GRCm39) missense probably damaging 1.00
R0023:Fbxw26 UTSW 9 109,547,079 (GRCm39) missense probably benign 0.01
R0087:Fbxw26 UTSW 9 109,554,006 (GRCm39) missense probably benign
R0369:Fbxw26 UTSW 9 109,552,780 (GRCm39) critical splice donor site probably null
R0446:Fbxw26 UTSW 9 109,572,788 (GRCm39) missense probably benign 0.03
R1844:Fbxw26 UTSW 9 109,553,946 (GRCm39) missense probably benign 0.42
R1891:Fbxw26 UTSW 9 109,551,232 (GRCm39) missense probably benign 0.34
R2042:Fbxw26 UTSW 9 109,561,772 (GRCm39) missense probably damaging 1.00
R3615:Fbxw26 UTSW 9 109,572,828 (GRCm39) nonsense probably null
R3616:Fbxw26 UTSW 9 109,572,828 (GRCm39) nonsense probably null
R4659:Fbxw26 UTSW 9 109,573,939 (GRCm39) missense probably damaging 0.97
R4785:Fbxw26 UTSW 9 109,553,868 (GRCm39) missense possibly damaging 0.50
R4898:Fbxw26 UTSW 9 109,547,037 (GRCm39) missense possibly damaging 0.95
R5791:Fbxw26 UTSW 9 109,574,221 (GRCm39) missense probably damaging 1.00
R5818:Fbxw26 UTSW 9 109,561,634 (GRCm39) missense probably benign
R5921:Fbxw26 UTSW 9 109,575,086 (GRCm39) missense probably damaging 1.00
R5983:Fbxw26 UTSW 9 109,547,033 (GRCm39) missense possibly damaging 0.49
R6145:Fbxw26 UTSW 9 109,561,691 (GRCm39) missense probably benign 0.09
R6209:Fbxw26 UTSW 9 109,547,033 (GRCm39) missense possibly damaging 0.49
R6412:Fbxw26 UTSW 9 109,561,715 (GRCm39) missense probably damaging 0.97
R6842:Fbxw26 UTSW 9 109,553,988 (GRCm39) missense probably damaging 1.00
R7228:Fbxw26 UTSW 9 109,554,012 (GRCm39) missense possibly damaging 0.93
R7467:Fbxw26 UTSW 9 109,561,765 (GRCm39) missense probably benign 0.00
R8397:Fbxw26 UTSW 9 109,561,715 (GRCm39) missense probably damaging 0.99
R8912:Fbxw26 UTSW 9 109,561,717 (GRCm39) missense probably damaging 1.00
R9284:Fbxw26 UTSW 9 109,550,962 (GRCm39) intron probably benign
R9479:Fbxw26 UTSW 9 109,561,625 (GRCm39) missense probably damaging 0.99
R9694:Fbxw26 UTSW 9 109,575,135 (GRCm39) start gained probably benign
X0020:Fbxw26 UTSW 9 109,561,700 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTACCTCAAATTGGCAAGTG -3'
(R):5'- TTCTTGTAAGAAGGGATTCCACTCTG -3'

Sequencing Primer
(F):5'- CCTCAAATTGGCAAGTGTTTTG -3'
(R):5'- CTCTGGATTAGGCTTCCAAATAAAGC -3'
Posted On 2019-10-07