Incidental Mutation 'R7451:Nktr'
ID577735
Institutional Source Beutler Lab
Gene Symbol Nktr
Ensembl Gene ENSMUSG00000032525
Gene Namenatural killer tumor recognition sequence
Synonyms5330401F18Rik, D9Wsu172e
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.572) question?
Stock #R7451 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location121719169-121756843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121729656 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 88 (S88T)
Ref Sequence ENSEMBL: ENSMUSP00000035112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035112] [ENSMUST00000182179] [ENSMUST00000182225] [ENSMUST00000182311] [ENSMUST00000182337] [ENSMUST00000182763] [ENSMUST00000183070]
Predicted Effect probably damaging
Transcript: ENSMUST00000035112
AA Change: S88T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035112
Gene: ENSMUSG00000032525
AA Change: S88T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 175 1.7e-48 PFAM
low complexity region 195 229 N/A INTRINSIC
low complexity region 277 294 N/A INTRINSIC
low complexity region 346 360 N/A INTRINSIC
low complexity region 427 459 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
low complexity region 509 565 N/A INTRINSIC
low complexity region 677 726 N/A INTRINSIC
low complexity region 736 749 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
low complexity region 900 914 N/A INTRINSIC
low complexity region 921 929 N/A INTRINSIC
low complexity region 948 958 N/A INTRINSIC
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1189 1200 N/A INTRINSIC
low complexity region 1229 1236 N/A INTRINSIC
low complexity region 1316 1453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182179
AA Change: S88T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138437
Gene: ENSMUSG00000032525
AA Change: S88T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 103 1.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182225
AA Change: S88T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138168
Gene: ENSMUSG00000032525
AA Change: S88T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 175 2.1e-47 PFAM
low complexity region 184 215 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 321 335 N/A INTRINSIC
low complexity region 402 434 N/A INTRINSIC
low complexity region 452 478 N/A INTRINSIC
low complexity region 484 540 N/A INTRINSIC
low complexity region 652 701 N/A INTRINSIC
low complexity region 711 724 N/A INTRINSIC
low complexity region 772 787 N/A INTRINSIC
low complexity region 875 889 N/A INTRINSIC
low complexity region 896 904 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182311
AA Change: S52T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138690
Gene: ENSMUSG00000032525
AA Change: S52T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 54 2.9e-8 PFAM
Pfam:Pro_isomerase 44 99 7.1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182337
AA Change: S81T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138164
Gene: ENSMUSG00000032525
AA Change: S81T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 7 101 1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182763
AA Change: S52T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138272
Gene: ENSMUSG00000032525
AA Change: S52T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 68 3.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183070
AA Change: S88T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138611
Gene: ENSMUSG00000032525
AA Change: S88T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 103 1.9e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-anchored protein with a hydrophobic amino terminal domain and a cyclophilin-like PPIase domain. It is present on the surface of natural killer cells and facilitates their binding to targets. Its expression is regulated by IL2 activation of the cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,457 N147I possibly damaging Het
4932438A13Rik G T 3: 37,022,807 probably null Het
Abcb6 A G 1: 75,172,153 I794T probably damaging Het
Abcc5 T A 16: 20,375,070 H767L probably damaging Het
Adgrb2 A T 4: 130,014,557 M1031L probably damaging Het
Akna T A 4: 63,378,667 M891L probably benign Het
Aloxe3 C A 11: 69,142,920 T620K possibly damaging Het
Amph A G 13: 19,077,368 Y63C probably damaging Het
Asprv1 A G 6: 86,628,948 I259V probably benign Het
Atp7b C T 8: 22,014,684 W652* probably null Het
Atp8a2 C T 14: 59,791,181 D946N probably null Het
BC024063 T A 10: 82,108,742 N65K probably benign Het
Bean1 A T 8: 104,213,996 M154L probably benign Het
Cacna1c C T 6: 118,594,020 V2181M unknown Het
Cacna1g A G 11: 94,429,075 I1425T probably damaging Het
Caskin2 A G 11: 115,812,155 probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfd T A 10: 79,891,528 V43E probably damaging Het
Chd9 GCCCC GCCC 8: 91,033,790 probably null Het
Chd9 T A 8: 91,033,818 S2064T probably benign Het
Cpsf2 T G 12: 102,000,792 V646G possibly damaging Het
Ctif T C 18: 75,519,803 D461G possibly damaging Het
Cyp3a41a T A 5: 145,699,740 E414D probably benign Het
Dagla A G 19: 10,253,355 V544A probably damaging Het
Dhx57 A T 17: 80,247,113 V1228E probably damaging Het
Eif2b3 T A 4: 117,052,796 L176* probably null Het
Fbxw26 T A 9: 109,732,623 I168L probably benign Het
Flt3 T A 5: 147,349,667 Y703F probably damaging Het
Frmpd1 C T 4: 45,279,558 P761L probably benign Het
Gabrd A G 4: 155,388,459 V89A possibly damaging Het
Galnt14 A T 17: 73,574,809 H98Q probably benign Het
Gli3 T C 13: 15,726,291 V1421A possibly damaging Het
Gprin2 A G 14: 34,195,805 S3P probably damaging Het
Ifi211 T G 1: 173,899,492 D362A probably damaging Het
Lars G T 18: 42,202,550 T1167K probably benign Het
Lce1b T C 3: 92,655,900 S109G unknown Het
Lrp2 T G 2: 69,513,333 E894A probably damaging Het
Mamdc4 A G 2: 25,564,461 V1081A possibly damaging Het
Mcub T C 3: 129,917,103 S227G possibly damaging Het
Mki67 A G 7: 135,699,351 I1318T probably benign Het
Mybl2 C T 2: 163,072,706 T248I possibly damaging Het
Myo9b A T 8: 71,352,188 H1441L probably benign Het
Nav2 T A 7: 49,552,829 probably null Het
Neb C T 2: 52,201,454 V5339I probably benign Het
Nup155 C T 15: 8,145,607 Q963* probably null Het
Oas1c A C 5: 120,802,142 L320V possibly damaging Het
Olfr108 C A 17: 37,446,305 S261R probably damaging Het
Olfr1254 A G 2: 89,789,109 M81T probably benign Het
Olfr1338 C T 4: 118,753,687 A286T probably benign Het
Olfr149 G A 9: 39,702,127 T214I probably damaging Het
Olfr325 A G 11: 58,581,690 Y282C probably damaging Het
Olfr548-ps1 T C 7: 102,542,254 I106T probably benign Het
Pcdhga7 A G 18: 37,716,004 S355G possibly damaging Het
Pde11a C T 2: 76,022,773 V834I possibly damaging Het
Pdzrn4 A T 15: 92,770,067 D700V possibly damaging Het
Pif1 C A 9: 65,588,348 P180Q probably benign Het
Pkig G T 2: 163,721,163 E5* probably null Het
Pla2r1 T A 2: 60,535,002 M75L probably damaging Het
Pllp T C 8: 94,676,243 S157G probably damaging Het
Ppfia1 A T 7: 144,508,210 H566Q probably benign Het
Ptpn13 A G 5: 103,527,095 D646G probably benign Het
Rab11fip5 T A 6: 85,341,556 T784S probably benign Het
Rad51ap2 T G 12: 11,457,981 S635A probably benign Het
Ranbp17 A T 11: 33,284,114 probably null Het
Rce1 C T 19: 4,625,053 G111D probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rimbp2 C T 5: 128,788,371 V631I probably benign Het
Scai T C 2: 39,125,136 T94A probably damaging Het
Sfmbt1 G A 14: 30,816,811 A796T probably benign Het
Slc6a11 C A 6: 114,245,683 Y546* probably null Het
Slc7a2 T C 8: 40,912,649 S506P probably damaging Het
Synj2 T A 17: 6,029,791 N1098K possibly damaging Het
Tmem177 G A 1: 119,910,241 A236V probably damaging Het
Togaram1 T A 12: 64,996,975 D1249E probably damaging Het
Trav17 A T 14: 53,806,639 M1L probably damaging Het
Trim25 C A 11: 89,015,737 A433D possibly damaging Het
Trim69 T C 2: 122,168,027 F160S probably benign Het
Trio A T 15: 27,747,913 V1407E probably benign Het
Trpm7 A T 2: 126,826,737 M753K probably damaging Het
Ttc12 G T 9: 49,471,879 A75E probably benign Het
Uchl4 A T 9: 64,235,731 I165L probably benign Het
Uvrag A T 7: 99,140,913 L13Q unknown Het
Wwc2 G A 8: 47,864,575 R656W not run Het
Other mutations in Nktr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Nktr APN 9 121731564 missense possibly damaging 0.94
IGL01402:Nktr APN 9 121741152 splice site probably null
IGL01404:Nktr APN 9 121741152 splice site probably null
IGL02945:Nktr APN 9 121728631 missense probably damaging 1.00
IGL03334:Nktr APN 9 121748176 missense probably benign 0.18
IGL03134:Nktr UTSW 9 121746466 missense probably damaging 1.00
PIT4131001:Nktr UTSW 9 121741621 missense probably damaging 1.00
R0010:Nktr UTSW 9 121741166 splice site probably benign
R0158:Nktr UTSW 9 121750691 unclassified probably benign
R0399:Nktr UTSW 9 121731484 missense probably damaging 0.98
R0503:Nktr UTSW 9 121750740 unclassified probably benign
R0585:Nktr UTSW 9 121754280 utr 3 prime probably benign
R0606:Nktr UTSW 9 121749290 unclassified probably benign
R1248:Nktr UTSW 9 121727370 missense probably damaging 1.00
R1899:Nktr UTSW 9 121748866 unclassified probably benign
R1912:Nktr UTSW 9 121750240 unclassified probably benign
R2049:Nktr UTSW 9 121741694 missense probably damaging 1.00
R2279:Nktr UTSW 9 121731537 missense possibly damaging 0.93
R2912:Nktr UTSW 9 121749604 unclassified probably benign
R2913:Nktr UTSW 9 121749604 unclassified probably benign
R2914:Nktr UTSW 9 121749604 unclassified probably benign
R3939:Nktr UTSW 9 121749069 unclassified probably benign
R4080:Nktr UTSW 9 121741126 missense probably damaging 1.00
R4471:Nktr UTSW 9 121748896 unclassified probably benign
R4472:Nktr UTSW 9 121748896 unclassified probably benign
R4506:Nktr UTSW 9 121748883 unclassified probably benign
R4556:Nktr UTSW 9 121741123 missense probably damaging 0.98
R4736:Nktr UTSW 9 121749739 unclassified probably benign
R4749:Nktr UTSW 9 121741693 missense probably damaging 1.00
R4943:Nktr UTSW 9 121719954 intron probably benign
R5084:Nktr UTSW 9 121748110 missense possibly damaging 0.86
R5250:Nktr UTSW 9 121749792 unclassified probably benign
R5288:Nktr UTSW 9 121748593 missense probably benign 0.23
R5324:Nktr UTSW 9 121727346 missense probably damaging 1.00
R5330:Nktr UTSW 9 121752768 intron probably benign
R5331:Nktr UTSW 9 121752768 intron probably benign
R5502:Nktr UTSW 9 121748606 unclassified probably benign
R5587:Nktr UTSW 9 121748489 unclassified probably benign
R5664:Nktr UTSW 9 121749417 nonsense probably null
R6005:Nktr UTSW 9 121748394 unclassified probably benign
R6057:Nktr UTSW 9 121748389 unclassified probably benign
R6083:Nktr UTSW 9 121750136 unclassified probably benign
R6274:Nktr UTSW 9 121731565 missense probably damaging 1.00
R6445:Nktr UTSW 9 121748414 unclassified probably benign
R6467:Nktr UTSW 9 121731519 missense probably damaging 1.00
R6911:Nktr UTSW 9 121754326 nonsense probably null
R6960:Nktr UTSW 9 121742692 missense probably damaging 0.99
R7226:Nktr UTSW 9 121746533 missense probably damaging 0.99
R7324:Nktr UTSW 9 121727361 missense probably damaging 1.00
R7324:Nktr UTSW 9 121748291 missense possibly damaging 0.66
R7464:Nktr UTSW 9 121750327 missense unknown
R7537:Nktr UTSW 9 121749279 missense unknown
R8126:Nktr UTSW 9 121746448 missense probably damaging 1.00
R8163:Nktr UTSW 9 121750863 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAAAGGTTTCAGAGTTCCTTCAAC -3'
(R):5'- TTTATCCCCAAGCTCATGCAAATAAAG -3'

Sequencing Primer
(F):5'- ATAACCTGAGTTCAGTCCCTGGG -3'
(R):5'- TGCAAATAAAGTATTTTCATGCAGC -3'
Posted On2019-10-07