Incidental Mutation 'R7451:Nktr'
ID577735
Institutional Source Beutler Lab
Gene Symbol Nktr
Ensembl Gene ENSMUSG00000032525
Gene Namenatural killer tumor recognition sequence
Synonyms5330401F18Rik, D9Wsu172e
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.451) question?
Stock #R7451 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location121719169-121756843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121729656 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 88 (S88T)
Ref Sequence ENSEMBL: ENSMUSP00000035112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035112] [ENSMUST00000182179] [ENSMUST00000182225] [ENSMUST00000182311] [ENSMUST00000182337] [ENSMUST00000182763] [ENSMUST00000183070]
Predicted Effect probably damaging
Transcript: ENSMUST00000035112
AA Change: S88T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035112
Gene: ENSMUSG00000032525
AA Change: S88T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 175 1.7e-48 PFAM
low complexity region 195 229 N/A INTRINSIC
low complexity region 277 294 N/A INTRINSIC
low complexity region 346 360 N/A INTRINSIC
low complexity region 427 459 N/A INTRINSIC
low complexity region 477 503 N/A INTRINSIC
low complexity region 509 565 N/A INTRINSIC
low complexity region 677 726 N/A INTRINSIC
low complexity region 736 749 N/A INTRINSIC
low complexity region 797 812 N/A INTRINSIC
low complexity region 900 914 N/A INTRINSIC
low complexity region 921 929 N/A INTRINSIC
low complexity region 948 958 N/A INTRINSIC
low complexity region 983 1003 N/A INTRINSIC
low complexity region 1189 1200 N/A INTRINSIC
low complexity region 1229 1236 N/A INTRINSIC
low complexity region 1316 1453 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182179
AA Change: S88T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138437
Gene: ENSMUSG00000032525
AA Change: S88T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 103 1.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182225
AA Change: S88T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138168
Gene: ENSMUSG00000032525
AA Change: S88T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 175 2.1e-47 PFAM
low complexity region 184 215 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 321 335 N/A INTRINSIC
low complexity region 402 434 N/A INTRINSIC
low complexity region 452 478 N/A INTRINSIC
low complexity region 484 540 N/A INTRINSIC
low complexity region 652 701 N/A INTRINSIC
low complexity region 711 724 N/A INTRINSIC
low complexity region 772 787 N/A INTRINSIC
low complexity region 875 889 N/A INTRINSIC
low complexity region 896 904 N/A INTRINSIC
low complexity region 923 933 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182311
AA Change: S52T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138690
Gene: ENSMUSG00000032525
AA Change: S52T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 54 2.9e-8 PFAM
Pfam:Pro_isomerase 44 99 7.1e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182337
AA Change: S81T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138164
Gene: ENSMUSG00000032525
AA Change: S81T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 7 101 1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182763
AA Change: S52T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138272
Gene: ENSMUSG00000032525
AA Change: S52T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 68 3.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183070
AA Change: S88T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138611
Gene: ENSMUSG00000032525
AA Change: S88T

DomainStartEndE-ValueType
Pfam:Pro_isomerase 10 103 1.9e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-anchored protein with a hydrophobic amino terminal domain and a cyclophilin-like PPIase domain. It is present on the surface of natural killer cells and facilitates their binding to targets. Its expression is regulated by IL2 activation of the cells. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,457 N147I possibly damaging Het
Abcb6 A G 1: 75,172,153 I794T probably damaging Het
Abcc5 T A 16: 20,375,070 H767L probably damaging Het
Adgrb2 A T 4: 130,014,557 M1031L probably damaging Het
Akna T A 4: 63,378,667 M891L probably benign Het
Aloxe3 C A 11: 69,142,920 T620K possibly damaging Het
Amph A G 13: 19,077,368 Y63C probably damaging Het
Asprv1 A G 6: 86,628,948 I259V probably benign Het
Atp7b C T 8: 22,014,684 W652* probably null Het
Atp8a2 C T 14: 59,791,181 D946N probably null Het
BC024063 T A 10: 82,108,742 N65K probably benign Het
Bean1 A T 8: 104,213,996 M154L probably benign Het
Cacna1c C T 6: 118,594,020 V2181M unknown Het
Cacna1g A G 11: 94,429,075 I1425T probably damaging Het
Caskin2 A G 11: 115,812,155 probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfd T A 10: 79,891,528 V43E probably damaging Het
Chd9 GCCCC GCCC 8: 91,033,790 probably null Het
Chd9 T A 8: 91,033,818 S2064T probably benign Het
Cpsf2 T G 12: 102,000,792 V646G possibly damaging Het
Ctif T C 18: 75,519,803 D461G possibly damaging Het
Cyp3a41a T A 5: 145,699,740 E414D probably benign Het
Dagla A G 19: 10,253,355 V544A probably damaging Het
Dhx57 A T 17: 80,247,113 V1228E probably damaging Het
Eif2b3 T A 4: 117,052,796 L176* probably null Het
Fbxw26 T A 9: 109,732,623 I168L probably benign Het
Flt3 T A 5: 147,349,667 Y703F probably damaging Het
Frmpd1 C T 4: 45,279,558 P761L probably benign Het
Gabrd A G 4: 155,388,459 V89A possibly damaging Het
Galnt14 A T 17: 73,574,809 H98Q probably benign Het
Gli3 T C 13: 15,726,291 V1421A possibly damaging Het
Gprin2 A G 14: 34,195,805 S3P probably damaging Het
Ifi211 T G 1: 173,899,492 D362A probably damaging Het
Lars G T 18: 42,202,550 T1167K probably benign Het
Lce1b T C 3: 92,655,900 S109G unknown Het
Lrp2 T G 2: 69,513,333 E894A probably damaging Het
Mamdc4 A G 2: 25,564,461 V1081A possibly damaging Het
Mcub T C 3: 129,917,103 S227G possibly damaging Het
Mki67 A G 7: 135,699,351 I1318T probably benign Het
Mybl2 C T 2: 163,072,706 T248I possibly damaging Het
Myo9b A T 8: 71,352,188 H1441L probably benign Het
Neb C T 2: 52,201,454 V5339I probably benign Het
Nup155 C T 15: 8,145,607 Q963* probably null Het
Oas1c A C 5: 120,802,142 L320V possibly damaging Het
Olfr108 C A 17: 37,446,305 S261R probably damaging Het
Olfr1254 A G 2: 89,789,109 M81T probably benign Het
Olfr1338 C T 4: 118,753,687 A286T probably benign Het
Olfr149 G A 9: 39,702,127 T214I probably damaging Het
Olfr325 A G 11: 58,581,690 Y282C probably damaging Het
Olfr548-ps1 T C 7: 102,542,254 I106T probably benign Het
Pcdhga7 A G 18: 37,716,004 S355G possibly damaging Het
Pde11a C T 2: 76,022,773 V834I possibly damaging Het
Pdzrn4 A T 15: 92,770,067 D700V possibly damaging Het
Pif1 C A 9: 65,588,348 P180Q probably benign Het
Pkig G T 2: 163,721,163 E5* probably null Het
Pla2r1 T A 2: 60,535,002 M75L probably damaging Het
Pllp T C 8: 94,676,243 S157G probably damaging Het
Ppfia1 A T 7: 144,508,210 H566Q probably benign Het
Ptpn13 A G 5: 103,527,095 D646G probably benign Het
Rab11fip5 T A 6: 85,341,556 T784S probably benign Het
Rad51ap2 T G 12: 11,457,981 S635A probably benign Het
Rce1 C T 19: 4,625,053 G111D probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rimbp2 C T 5: 128,788,371 V631I probably benign Het
Scai T C 2: 39,125,136 T94A probably damaging Het
Sfmbt1 G A 14: 30,816,811 A796T probably benign Het
Slc6a11 C A 6: 114,245,683 Y546* probably null Het
Slc7a2 T C 8: 40,912,649 S506P probably damaging Het
Synj2 T A 17: 6,029,791 N1098K possibly damaging Het
Tmem177 G A 1: 119,910,241 A236V probably damaging Het
Togaram1 T A 12: 64,996,975 D1249E probably damaging Het
Trav17 A T 14: 53,806,639 M1L probably damaging Het
Trim25 C A 11: 89,015,737 A433D possibly damaging Het
Trim69 T C 2: 122,168,027 F160S probably benign Het
Trio A T 15: 27,747,913 V1407E probably benign Het
Trpm7 A T 2: 126,826,737 M753K probably damaging Het
Ttc12 G T 9: 49,471,879 A75E probably benign Het
Uchl4 A T 9: 64,235,731 I165L probably benign Het
Uvrag A T 7: 99,140,913 L13Q unknown Het
Wwc2 G A 8: 47,864,575 R656W not run Het
Other mutations in Nktr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Nktr APN 9 121731564 missense possibly damaging 0.94
IGL01402:Nktr APN 9 121741152 splice site probably null
IGL01404:Nktr APN 9 121741152 splice site probably null
IGL02945:Nktr APN 9 121728631 missense probably damaging 1.00
IGL03334:Nktr APN 9 121748176 missense probably benign 0.18
IGL03134:Nktr UTSW 9 121746466 missense probably damaging 1.00
PIT4131001:Nktr UTSW 9 121741621 missense probably damaging 1.00
R0010:Nktr UTSW 9 121741166 splice site probably benign
R0158:Nktr UTSW 9 121750691 unclassified probably benign
R0399:Nktr UTSW 9 121731484 missense probably damaging 0.98
R0503:Nktr UTSW 9 121750740 unclassified probably benign
R0585:Nktr UTSW 9 121754280 utr 3 prime probably benign
R0606:Nktr UTSW 9 121749290 unclassified probably benign
R1248:Nktr UTSW 9 121727370 missense probably damaging 1.00
R1899:Nktr UTSW 9 121748866 unclassified probably benign
R1912:Nktr UTSW 9 121750240 unclassified probably benign
R2049:Nktr UTSW 9 121741694 missense probably damaging 1.00
R2279:Nktr UTSW 9 121731537 missense possibly damaging 0.93
R2912:Nktr UTSW 9 121749604 unclassified probably benign
R2913:Nktr UTSW 9 121749604 unclassified probably benign
R2914:Nktr UTSW 9 121749604 unclassified probably benign
R3939:Nktr UTSW 9 121749069 unclassified probably benign
R4080:Nktr UTSW 9 121741126 missense probably damaging 1.00
R4471:Nktr UTSW 9 121748896 unclassified probably benign
R4472:Nktr UTSW 9 121748896 unclassified probably benign
R4506:Nktr UTSW 9 121748883 unclassified probably benign
R4556:Nktr UTSW 9 121741123 missense probably damaging 0.98
R4736:Nktr UTSW 9 121749739 unclassified probably benign
R4749:Nktr UTSW 9 121741693 missense probably damaging 1.00
R4943:Nktr UTSW 9 121719954 intron probably benign
R5084:Nktr UTSW 9 121748110 missense possibly damaging 0.86
R5250:Nktr UTSW 9 121749792 unclassified probably benign
R5288:Nktr UTSW 9 121748593 missense probably benign 0.23
R5324:Nktr UTSW 9 121727346 missense probably damaging 1.00
R5330:Nktr UTSW 9 121752768 intron probably benign
R5331:Nktr UTSW 9 121752768 intron probably benign
R5502:Nktr UTSW 9 121748606 unclassified probably benign
R5587:Nktr UTSW 9 121748489 unclassified probably benign
R5664:Nktr UTSW 9 121749417 nonsense probably null
R6005:Nktr UTSW 9 121748394 unclassified probably benign
R6057:Nktr UTSW 9 121748389 unclassified probably benign
R6083:Nktr UTSW 9 121750136 unclassified probably benign
R6274:Nktr UTSW 9 121731565 missense probably damaging 1.00
R6445:Nktr UTSW 9 121748414 unclassified probably benign
R6467:Nktr UTSW 9 121731519 missense probably damaging 1.00
R6911:Nktr UTSW 9 121754326 nonsense probably null
R6960:Nktr UTSW 9 121742692 missense probably damaging 0.99
R7226:Nktr UTSW 9 121746533 missense probably damaging 0.99
R7324:Nktr UTSW 9 121727361 missense probably damaging 1.00
R7324:Nktr UTSW 9 121748291 missense possibly damaging 0.66
R7464:Nktr UTSW 9 121750327 missense unknown
R7537:Nktr UTSW 9 121749279 missense unknown
Predicted Primers PCR Primer
(F):5'- AAAAGGTTTCAGAGTTCCTTCAAC -3'
(R):5'- TTTATCCCCAAGCTCATGCAAATAAAG -3'

Sequencing Primer
(F):5'- ATAACCTGAGTTCAGTCCCTGGG -3'
(R):5'- TGCAAATAAAGTATTTTCATGCAGC -3'
Posted On2019-10-07