Incidental Mutation 'R7451:1700006E09Rik'
ID577742
Institutional Source Beutler Lab
Gene Symbol 1700006E09Rik
Ensembl Gene ENSMUSG00000010841
Gene NameRIKEN cDNA 1700006E09 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7451 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location101984279-101992264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 101991457 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 147 (N147I)
Ref Sequence ENSEMBL: ENSMUSP00000010985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010985] [ENSMUST00000107172] [ENSMUST00000107173] [ENSMUST00000175972] [ENSMUST00000176722]
Predicted Effect possibly damaging
Transcript: ENSMUST00000010985
AA Change: N147I

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000010985
Gene: ENSMUSG00000010841
AA Change: N147I

DomainStartEndE-ValueType
Pfam:KIAA1430 35 130 1.1e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107172
SMART Domains Protein: ENSMUSP00000102790
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 29 176 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107173
SMART Domains Protein: ENSMUSP00000102791
Gene: ENSMUSG00000003518

DomainStartEndE-ValueType
DSPc 54 201 8.04e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175972
Predicted Effect possibly damaging
Transcript: ENSMUST00000176722
AA Change: N96I

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134890
Gene: ENSMUSG00000010841
AA Change: N96I

DomainStartEndE-ValueType
Pfam:KIAA1430 1 80 4.8e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 37,022,807 probably null Het
Abcb6 A G 1: 75,172,153 I794T probably damaging Het
Abcc5 T A 16: 20,375,070 H767L probably damaging Het
Adgrb2 A T 4: 130,014,557 M1031L probably damaging Het
Akna T A 4: 63,378,667 M891L probably benign Het
Aloxe3 C A 11: 69,142,920 T620K possibly damaging Het
Amph A G 13: 19,077,368 Y63C probably damaging Het
Asprv1 A G 6: 86,628,948 I259V probably benign Het
Atp7b C T 8: 22,014,684 W652* probably null Het
Atp8a2 C T 14: 59,791,181 D946N probably null Het
BC024063 T A 10: 82,108,742 N65K probably benign Het
Bean1 A T 8: 104,213,996 M154L probably benign Het
Cacna1c C T 6: 118,594,020 V2181M unknown Het
Cacna1g A G 11: 94,429,075 I1425T probably damaging Het
Caskin2 A G 11: 115,812,155 probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfd T A 10: 79,891,528 V43E probably damaging Het
Chd9 GCCCC GCCC 8: 91,033,790 probably null Het
Chd9 T A 8: 91,033,818 S2064T probably benign Het
Cpsf2 T G 12: 102,000,792 V646G possibly damaging Het
Ctif T C 18: 75,519,803 D461G possibly damaging Het
Cyp3a41a T A 5: 145,699,740 E414D probably benign Het
Dagla A G 19: 10,253,355 V544A probably damaging Het
Dhx57 A T 17: 80,247,113 V1228E probably damaging Het
Eif2b3 T A 4: 117,052,796 L176* probably null Het
Fbxw26 T A 9: 109,732,623 I168L probably benign Het
Flt3 T A 5: 147,349,667 Y703F probably damaging Het
Frmpd1 C T 4: 45,279,558 P761L probably benign Het
Gabrd A G 4: 155,388,459 V89A possibly damaging Het
Galnt14 A T 17: 73,574,809 H98Q probably benign Het
Gli3 T C 13: 15,726,291 V1421A possibly damaging Het
Gprin2 A G 14: 34,195,805 S3P probably damaging Het
Ifi211 T G 1: 173,899,492 D362A probably damaging Het
Lars G T 18: 42,202,550 T1167K probably benign Het
Lce1b T C 3: 92,655,900 S109G unknown Het
Lrp2 T G 2: 69,513,333 E894A probably damaging Het
Mamdc4 A G 2: 25,564,461 V1081A possibly damaging Het
Mcub T C 3: 129,917,103 S227G possibly damaging Het
Mki67 A G 7: 135,699,351 I1318T probably benign Het
Mybl2 C T 2: 163,072,706 T248I possibly damaging Het
Myo9b A T 8: 71,352,188 H1441L probably benign Het
Nav2 T A 7: 49,552,829 probably null Het
Neb C T 2: 52,201,454 V5339I probably benign Het
Nktr T A 9: 121,729,656 S88T probably damaging Het
Nup155 C T 15: 8,145,607 Q963* probably null Het
Oas1c A C 5: 120,802,142 L320V possibly damaging Het
Olfr108 C A 17: 37,446,305 S261R probably damaging Het
Olfr1254 A G 2: 89,789,109 M81T probably benign Het
Olfr1338 C T 4: 118,753,687 A286T probably benign Het
Olfr149 G A 9: 39,702,127 T214I probably damaging Het
Olfr325 A G 11: 58,581,690 Y282C probably damaging Het
Olfr548-ps1 T C 7: 102,542,254 I106T probably benign Het
Pcdhga7 A G 18: 37,716,004 S355G possibly damaging Het
Pde11a C T 2: 76,022,773 V834I possibly damaging Het
Pdzrn4 A T 15: 92,770,067 D700V possibly damaging Het
Pif1 C A 9: 65,588,348 P180Q probably benign Het
Pkig G T 2: 163,721,163 E5* probably null Het
Pla2r1 T A 2: 60,535,002 M75L probably damaging Het
Pllp T C 8: 94,676,243 S157G probably damaging Het
Ppfia1 A T 7: 144,508,210 H566Q probably benign Het
Ptpn13 A G 5: 103,527,095 D646G probably benign Het
Rab11fip5 T A 6: 85,341,556 T784S probably benign Het
Rad51ap2 T G 12: 11,457,981 S635A probably benign Het
Ranbp17 A T 11: 33,284,114 probably null Het
Rce1 C T 19: 4,625,053 G111D probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rimbp2 C T 5: 128,788,371 V631I probably benign Het
Scai T C 2: 39,125,136 T94A probably damaging Het
Sfmbt1 G A 14: 30,816,811 A796T probably benign Het
Slc6a11 C A 6: 114,245,683 Y546* probably null Het
Slc7a2 T C 8: 40,912,649 S506P probably damaging Het
Synj2 T A 17: 6,029,791 N1098K possibly damaging Het
Tmem177 G A 1: 119,910,241 A236V probably damaging Het
Togaram1 T A 12: 64,996,975 D1249E probably damaging Het
Trav17 A T 14: 53,806,639 M1L probably damaging Het
Trim25 C A 11: 89,015,737 A433D possibly damaging Het
Trim69 T C 2: 122,168,027 F160S probably benign Het
Trio A T 15: 27,747,913 V1407E probably benign Het
Trpm7 A T 2: 126,826,737 M753K probably damaging Het
Ttc12 G T 9: 49,471,879 A75E probably benign Het
Uchl4 A T 9: 64,235,731 I165L probably benign Het
Uvrag A T 7: 99,140,913 L13Q unknown Het
Wwc2 G A 8: 47,864,575 R656W not run Het
Other mutations in 1700006E09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:1700006E09Rik APN 11 101990820 missense possibly damaging 0.75
IGL02442:1700006E09Rik APN 11 101990826 missense probably benign 0.00
R1802:1700006E09Rik UTSW 11 101988476 missense possibly damaging 0.56
R1937:1700006E09Rik UTSW 11 101987163 missense probably damaging 0.97
R2015:1700006E09Rik UTSW 11 101987218 missense probably damaging 1.00
R3732:1700006E09Rik UTSW 11 101988452 nonsense probably null
R3732:1700006E09Rik UTSW 11 101988452 nonsense probably null
R3733:1700006E09Rik UTSW 11 101988452 nonsense probably null
R3813:1700006E09Rik UTSW 11 101991488 missense probably benign 0.01
R5804:1700006E09Rik UTSW 11 101990814 missense probably damaging 1.00
R7351:1700006E09Rik UTSW 11 101991505 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCCCCATTTAGGAACAATTCTTC -3'
(R):5'- AGAATGAACGAGCTCTCAGC -3'

Sequencing Primer
(F):5'- GCCAGGACTAGTTAGTATTGAGATCC -3'
(R):5'- GCTCTCAGCTCCCTAAGTGG -3'
Posted On2019-10-07