Incidental Mutation 'R7451:Amph'
ID 577748
Institutional Source Beutler Lab
Gene Symbol Amph
Ensembl Gene ENSMUSG00000021314
Gene Name amphiphysin
Synonyms
MMRRC Submission 045525-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.284) question?
Stock # R7451 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 19132375-19335091 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19261538 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 63 (Y63C)
Ref Sequence ENSEMBL: ENSMUSP00000142766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003345] [ENSMUST00000200466]
AlphaFold Q7TQF7
Predicted Effect
SMART Domains Protein: ENSMUSP00000003345
Gene: ENSMUSG00000021314
AA Change: Y63C

DomainStartEndE-ValueType
BAR 12 233 8.47e-80 SMART
low complexity region 260 277 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
low complexity region 301 315 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 424 445 N/A INTRINSIC
low complexity region 479 499 N/A INTRINSIC
SH3 616 686 7.82e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200466
AA Change: Y63C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142766
Gene: ENSMUSG00000021314
AA Change: Y63C

DomainStartEndE-ValueType
BAR 12 233 2.3e-82 SMART
low complexity region 260 277 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
low complexity region 301 315 N/A INTRINSIC
low complexity region 341 362 N/A INTRINSIC
low complexity region 428 449 N/A INTRINSIC
low complexity region 483 503 N/A INTRINSIC
SH3 620 690 4.9e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein associated with the cytoplasmic surface of synaptic vesicles. A subset of patients with stiff-man syndrome who were also affected by breast cancer are positive for autoantibodies against this protein. Alternate splicing of this gene results in two transcript variants encoding different isoforms. Additional splice variants have been described, but their full length sequences have not been determined. A pseudogene of this gene is found on chromosome 11.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene exhibit learning deficits and synaptic vesicle recycling defects, and die between 2 to 5 months of age from rare irreversible seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb6 A G 1: 75,148,797 (GRCm39) I794T probably damaging Het
Abcc5 T A 16: 20,193,820 (GRCm39) H767L probably damaging Het
Adgrb2 A T 4: 129,908,350 (GRCm39) M1031L probably damaging Het
Akna T A 4: 63,296,904 (GRCm39) M891L probably benign Het
Aloxe3 C A 11: 69,033,746 (GRCm39) T620K possibly damaging Het
Asprv1 A G 6: 86,605,930 (GRCm39) I259V probably benign Het
Atp7b C T 8: 22,504,700 (GRCm39) W652* probably null Het
Atp8a2 C T 14: 60,028,630 (GRCm39) D946N probably null Het
BC024063 T A 10: 81,944,576 (GRCm39) N65K probably benign Het
Bean1 A T 8: 104,940,628 (GRCm39) M154L probably benign Het
Bltp1 G T 3: 37,076,956 (GRCm39) probably null Het
Cacna1c C T 6: 118,570,981 (GRCm39) V2181M unknown Het
Cacna1g A G 11: 94,319,901 (GRCm39) I1425T probably damaging Het
Caskin2 A G 11: 115,702,981 (GRCm39) probably benign Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Cfap97d1 A T 11: 101,882,283 (GRCm39) N147I possibly damaging Het
Cfd T A 10: 79,727,362 (GRCm39) V43E probably damaging Het
Chd9 GCCCC GCCC 8: 91,760,418 (GRCm39) probably null Het
Chd9 T A 8: 91,760,446 (GRCm39) S2064T probably benign Het
Cpsf2 T G 12: 101,967,051 (GRCm39) V646G possibly damaging Het
Ctif T C 18: 75,652,874 (GRCm39) D461G possibly damaging Het
Cyp3a41a T A 5: 145,636,550 (GRCm39) E414D probably benign Het
Dagla A G 19: 10,230,719 (GRCm39) V544A probably damaging Het
Dhx57 A T 17: 80,554,542 (GRCm39) V1228E probably damaging Het
Eif2b3 T A 4: 116,909,993 (GRCm39) L176* probably null Het
Fbxw26 T A 9: 109,561,691 (GRCm39) I168L probably benign Het
Flt3 T A 5: 147,286,477 (GRCm39) Y703F probably damaging Het
Frmpd1 C T 4: 45,279,558 (GRCm39) P761L probably benign Het
Gabrd A G 4: 155,472,916 (GRCm39) V89A possibly damaging Het
Galnt14 A T 17: 73,881,804 (GRCm39) H98Q probably benign Het
Gli3 T C 13: 15,900,876 (GRCm39) V1421A possibly damaging Het
Gprin2 A G 14: 33,917,762 (GRCm39) S3P probably damaging Het
Ifi211 T G 1: 173,727,058 (GRCm39) D362A probably damaging Het
Lars1 G T 18: 42,335,615 (GRCm39) T1167K probably benign Het
Lce1b T C 3: 92,563,207 (GRCm39) S109G unknown Het
Lrp2 T G 2: 69,343,677 (GRCm39) E894A probably damaging Het
Mamdc4 A G 2: 25,454,473 (GRCm39) V1081A possibly damaging Het
Mcub T C 3: 129,710,752 (GRCm39) S227G possibly damaging Het
Mki67 A G 7: 135,301,080 (GRCm39) I1318T probably benign Het
Mybl2 C T 2: 162,914,626 (GRCm39) T248I possibly damaging Het
Myo9b A T 8: 71,804,832 (GRCm39) H1441L probably benign Het
Nav2 T A 7: 49,202,577 (GRCm39) probably null Het
Neb C T 2: 52,091,466 (GRCm39) V5339I probably benign Het
Nktr T A 9: 121,558,722 (GRCm39) S88T probably damaging Het
Nup155 C T 15: 8,175,091 (GRCm39) Q963* probably null Het
Oas1c A C 5: 120,940,207 (GRCm39) L320V possibly damaging Het
Or10ak14 C T 4: 118,610,884 (GRCm39) A286T probably benign Het
Or10d1b G A 9: 39,613,423 (GRCm39) T214I probably damaging Het
Or1o11 C A 17: 37,757,196 (GRCm39) S261R probably damaging Het
Or2t46 A G 11: 58,472,516 (GRCm39) Y282C probably damaging Het
Or4a81 A G 2: 89,619,453 (GRCm39) M81T probably benign Het
Or52b4i T C 7: 102,191,461 (GRCm39) I106T probably benign Het
Pcdhga7 A G 18: 37,849,057 (GRCm39) S355G possibly damaging Het
Pde11a C T 2: 75,853,117 (GRCm39) V834I possibly damaging Het
Pdzrn4 A T 15: 92,667,948 (GRCm39) D700V possibly damaging Het
Pif1 C A 9: 65,495,630 (GRCm39) P180Q probably benign Het
Pkig G T 2: 163,563,083 (GRCm39) E5* probably null Het
Pla2r1 T A 2: 60,365,346 (GRCm39) M75L probably damaging Het
Pllp T C 8: 95,402,871 (GRCm39) S157G probably damaging Het
Ppfia1 A T 7: 144,061,947 (GRCm39) H566Q probably benign Het
Ptpn13 A G 5: 103,674,961 (GRCm39) D646G probably benign Het
Rab11fip5 T A 6: 85,318,538 (GRCm39) T784S probably benign Het
Rad51ap2 T G 12: 11,507,982 (GRCm39) S635A probably benign Het
Ranbp17 A T 11: 33,234,114 (GRCm39) probably null Het
Rce1 C T 19: 4,675,081 (GRCm39) G111D probably damaging Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rhox4d G A X: 36,700,645 (GRCm39) G191E unknown Het
Rimbp2 C T 5: 128,865,435 (GRCm39) V631I probably benign Het
Scai T C 2: 39,015,148 (GRCm39) T94A probably damaging Het
Sfmbt1 G A 14: 30,538,768 (GRCm39) A796T probably benign Het
Slc6a11 C A 6: 114,222,644 (GRCm39) Y546* probably null Het
Slc7a2 T C 8: 41,365,686 (GRCm39) S506P probably damaging Het
Synj2 T A 17: 6,080,066 (GRCm39) N1098K possibly damaging Het
Tmem177 G A 1: 119,837,971 (GRCm39) A236V probably damaging Het
Togaram1 T A 12: 65,043,749 (GRCm39) D1249E probably damaging Het
Trav17 A T 14: 54,044,096 (GRCm39) M1L probably damaging Het
Trim25 C A 11: 88,906,563 (GRCm39) A433D possibly damaging Het
Trim69 T C 2: 121,998,508 (GRCm39) F160S probably benign Het
Trio A T 15: 27,747,999 (GRCm39) V1407E probably benign Het
Trpm7 A T 2: 126,668,657 (GRCm39) M753K probably damaging Het
Ttc12 G T 9: 49,383,179 (GRCm39) A75E probably benign Het
Uchl4 A T 9: 64,143,013 (GRCm39) I165L probably benign Het
Uvrag A T 7: 98,790,120 (GRCm39) L13Q unknown Het
Wwc2 G A 8: 48,317,610 (GRCm39) R656W not run Het
Other mutations in Amph
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Amph APN 13 19,304,776 (GRCm39) missense probably damaging 1.00
IGL01866:Amph APN 13 19,326,172 (GRCm39) missense probably damaging 1.00
IGL02157:Amph APN 13 19,288,401 (GRCm39) missense possibly damaging 0.60
IGL02300:Amph APN 13 19,270,774 (GRCm39) missense probably damaging 1.00
IGL02435:Amph APN 13 19,323,333 (GRCm39) splice site probably benign
IGL03060:Amph APN 13 19,278,984 (GRCm39) missense probably damaging 0.99
IGL03122:Amph APN 13 19,287,113 (GRCm39) missense probably damaging 0.98
R0037:Amph UTSW 13 19,284,823 (GRCm39) missense possibly damaging 0.90
R0646:Amph UTSW 13 19,297,286 (GRCm39) missense possibly damaging 0.95
R0652:Amph UTSW 13 19,270,791 (GRCm39) splice site probably null
R1005:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1006:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1199:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1200:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1201:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1333:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1334:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1335:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1337:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1338:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1384:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1397:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1501:Amph UTSW 13 19,288,461 (GRCm39) nonsense probably null
R1528:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R1822:Amph UTSW 13 19,132,625 (GRCm39) missense probably damaging 0.98
R2004:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R2006:Amph UTSW 13 19,326,198 (GRCm39) missense probably damaging 0.97
R2061:Amph UTSW 13 19,309,205 (GRCm39) nonsense probably null
R2111:Amph UTSW 13 19,300,436 (GRCm39) splice site probably benign
R2329:Amph UTSW 13 19,323,520 (GRCm39) missense probably benign
R2878:Amph UTSW 13 19,288,437 (GRCm39) missense possibly damaging 0.95
R3121:Amph UTSW 13 19,297,316 (GRCm39) nonsense probably null
R3548:Amph UTSW 13 19,287,129 (GRCm39) missense probably damaging 1.00
R4059:Amph UTSW 13 19,326,168 (GRCm39) missense probably damaging 1.00
R4369:Amph UTSW 13 19,321,870 (GRCm39) missense probably benign 0.20
R4492:Amph UTSW 13 19,333,928 (GRCm39) missense possibly damaging 0.76
R4855:Amph UTSW 13 19,268,378 (GRCm39) missense probably damaging 1.00
R4937:Amph UTSW 13 19,288,515 (GRCm39) missense probably damaging 1.00
R4965:Amph UTSW 13 19,321,869 (GRCm39) missense probably benign 0.12
R5777:Amph UTSW 13 19,230,186 (GRCm39) missense probably damaging 1.00
R5787:Amph UTSW 13 19,132,624 (GRCm39) missense possibly damaging 0.75
R6091:Amph UTSW 13 19,309,293 (GRCm39) missense probably benign 0.01
R7100:Amph UTSW 13 19,334,011 (GRCm39) makesense probably null
R7103:Amph UTSW 13 19,333,908 (GRCm39) missense probably benign 0.00
R7522:Amph UTSW 13 19,270,715 (GRCm39) missense probably damaging 0.96
R8165:Amph UTSW 13 19,279,007 (GRCm39) missense probably benign 0.05
R8166:Amph UTSW 13 19,132,660 (GRCm39) missense possibly damaging 0.91
R8214:Amph UTSW 13 19,288,468 (GRCm39) missense possibly damaging 0.81
R9021:Amph UTSW 13 19,284,071 (GRCm39) missense probably benign 0.35
R9241:Amph UTSW 13 19,278,972 (GRCm39) missense probably damaging 1.00
R9469:Amph UTSW 13 19,270,769 (GRCm39) missense probably damaging 1.00
R9717:Amph UTSW 13 19,309,253 (GRCm39) missense probably benign 0.07
R9755:Amph UTSW 13 19,297,325 (GRCm39) missense probably damaging 1.00
V1662:Amph UTSW 13 19,323,540 (GRCm39) missense probably benign 0.36
Z1177:Amph UTSW 13 19,323,504 (GRCm39) missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- CCGAGATGGATGGGCATATTTTC -3'
(R):5'- TGCAGCTTTGCTTCAGTAAAC -3'

Sequencing Primer
(F):5'- GCATATTTTCTTGTTCAGATTGTGC -3'
(R):5'- CAGAAGGGCAGGTATATATTTGTCCC -3'
Posted On 2019-10-07