Incidental Mutation 'R7451:Abcc5'
ID577756
Institutional Source Beutler Lab
Gene Symbol Abcc5
Ensembl Gene ENSMUSG00000022822
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 5
Synonyms2900011L11Rik, Abcc5a, Mrp5, Abcc5b
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_013790.2, NM_176839.1; MGI:1351644

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7451 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location20331303-20426394 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 20375070 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 767 (H767L)
Ref Sequence ENSEMBL: ENSMUSP00000078158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079158] [ENSMUST00000115547] [ENSMUST00000232044]
Predicted Effect probably damaging
Transcript: ENSMUST00000079158
AA Change: H767L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078158
Gene: ENSMUSG00000022822
AA Change: H767L

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 1.6e-18 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1142 9.3e-36 PFAM
AAA 1218 1403 1.26e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115547
AA Change: H767L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111209
Gene: ENSMUSG00000022822
AA Change: H767L

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 2e-17 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1146 6.5e-30 PFAM
AAA 1218 1403 1.26e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232044
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (84/84)
MGI Phenotype Strain: 3794119
FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that the human protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display normal cGMP transport into erythrocyte membrane vesicles. [provided by MGI curators]
Allele List at MGI

All alleles(81) : Targeted(4) Gene trapped(77)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,457 N147I possibly damaging Het
4932438A13Rik G T 3: 37,022,807 probably null Het
Abcb6 A G 1: 75,172,153 I794T probably damaging Het
Adgrb2 A T 4: 130,014,557 M1031L probably damaging Het
Akna T A 4: 63,378,667 M891L probably benign Het
Aloxe3 C A 11: 69,142,920 T620K possibly damaging Het
Amph A G 13: 19,077,368 Y63C probably damaging Het
Asprv1 A G 6: 86,628,948 I259V probably benign Het
Atp7b C T 8: 22,014,684 W652* probably null Het
Atp8a2 C T 14: 59,791,181 D946N probably null Het
BC024063 T A 10: 82,108,742 N65K probably benign Het
Bean1 A T 8: 104,213,996 M154L probably benign Het
Cacna1c C T 6: 118,594,020 V2181M unknown Het
Cacna1g A G 11: 94,429,075 I1425T probably damaging Het
Caskin2 A G 11: 115,812,155 probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfd T A 10: 79,891,528 V43E probably damaging Het
Chd9 GCCCC GCCC 8: 91,033,790 probably null Het
Chd9 T A 8: 91,033,818 S2064T probably benign Het
Cpsf2 T G 12: 102,000,792 V646G possibly damaging Het
Ctif T C 18: 75,519,803 D461G possibly damaging Het
Cyp3a41a T A 5: 145,699,740 E414D probably benign Het
Dagla A G 19: 10,253,355 V544A probably damaging Het
Dhx57 A T 17: 80,247,113 V1228E probably damaging Het
Eif2b3 T A 4: 117,052,796 L176* probably null Het
Fbxw26 T A 9: 109,732,623 I168L probably benign Het
Flt3 T A 5: 147,349,667 Y703F probably damaging Het
Frmpd1 C T 4: 45,279,558 P761L probably benign Het
Gabrd A G 4: 155,388,459 V89A possibly damaging Het
Galnt14 A T 17: 73,574,809 H98Q probably benign Het
Gli3 T C 13: 15,726,291 V1421A possibly damaging Het
Gprin2 A G 14: 34,195,805 S3P probably damaging Het
Ifi211 T G 1: 173,899,492 D362A probably damaging Het
Lars G T 18: 42,202,550 T1167K probably benign Het
Lce1b T C 3: 92,655,900 S109G unknown Het
Lrp2 T G 2: 69,513,333 E894A probably damaging Het
Mamdc4 A G 2: 25,564,461 V1081A possibly damaging Het
Mcub T C 3: 129,917,103 S227G possibly damaging Het
Mki67 A G 7: 135,699,351 I1318T probably benign Het
Mybl2 C T 2: 163,072,706 T248I possibly damaging Het
Myo9b A T 8: 71,352,188 H1441L probably benign Het
Nav2 T A 7: 49,552,829 probably null Het
Neb C T 2: 52,201,454 V5339I probably benign Het
Nktr T A 9: 121,729,656 S88T probably damaging Het
Nup155 C T 15: 8,145,607 Q963* probably null Het
Oas1c A C 5: 120,802,142 L320V possibly damaging Het
Olfr108 C A 17: 37,446,305 S261R probably damaging Het
Olfr1254 A G 2: 89,789,109 M81T probably benign Het
Olfr1338 C T 4: 118,753,687 A286T probably benign Het
Olfr149 G A 9: 39,702,127 T214I probably damaging Het
Olfr325 A G 11: 58,581,690 Y282C probably damaging Het
Olfr548-ps1 T C 7: 102,542,254 I106T probably benign Het
Pcdhga7 A G 18: 37,716,004 S355G possibly damaging Het
Pde11a C T 2: 76,022,773 V834I possibly damaging Het
Pdzrn4 A T 15: 92,770,067 D700V possibly damaging Het
Pif1 C A 9: 65,588,348 P180Q probably benign Het
Pkig G T 2: 163,721,163 E5* probably null Het
Pla2r1 T A 2: 60,535,002 M75L probably damaging Het
Pllp T C 8: 94,676,243 S157G probably damaging Het
Ppfia1 A T 7: 144,508,210 H566Q probably benign Het
Ptpn13 A G 5: 103,527,095 D646G probably benign Het
Rab11fip5 T A 6: 85,341,556 T784S probably benign Het
Rad51ap2 T G 12: 11,457,981 S635A probably benign Het
Ranbp17 A T 11: 33,284,114 probably null Het
Rce1 C T 19: 4,625,053 G111D probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rimbp2 C T 5: 128,788,371 V631I probably benign Het
Scai T C 2: 39,125,136 T94A probably damaging Het
Sfmbt1 G A 14: 30,816,811 A796T probably benign Het
Slc6a11 C A 6: 114,245,683 Y546* probably null Het
Slc7a2 T C 8: 40,912,649 S506P probably damaging Het
Synj2 T A 17: 6,029,791 N1098K possibly damaging Het
Tmem177 G A 1: 119,910,241 A236V probably damaging Het
Togaram1 T A 12: 64,996,975 D1249E probably damaging Het
Trav17 A T 14: 53,806,639 M1L probably damaging Het
Trim25 C A 11: 89,015,737 A433D possibly damaging Het
Trim69 T C 2: 122,168,027 F160S probably benign Het
Trio A T 15: 27,747,913 V1407E probably benign Het
Trpm7 A T 2: 126,826,737 M753K probably damaging Het
Ttc12 G T 9: 49,471,879 A75E probably benign Het
Uchl4 A T 9: 64,235,731 I165L probably benign Het
Uvrag A T 7: 99,140,913 L13Q unknown Het
Wwc2 G A 8: 47,864,575 R656W not run Het
Other mutations in Abcc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Abcc5 APN 16 20422357 missense probably benign 0.01
IGL00928:Abcc5 APN 16 20398970 unclassified probably benign
IGL01350:Abcc5 APN 16 20368458 missense probably benign 0.00
IGL01774:Abcc5 APN 16 20378457 missense probably damaging 1.00
IGL01934:Abcc5 APN 16 20422441 utr 5 prime probably benign
IGL02413:Abcc5 APN 16 20422437 utr 5 prime probably benign
IGL02426:Abcc5 APN 16 20338925 missense probably damaging 0.98
IGL02797:Abcc5 APN 16 20368464 missense probably benign 0.06
IGL02938:Abcc5 APN 16 20362229 missense possibly damaging 0.64
IGL03367:Abcc5 APN 16 20392811 utr 3 prime probably benign
IGL03411:Abcc5 APN 16 20399560 missense probably damaging 0.97
PIT4508001:Abcc5 UTSW 16 20357378 missense probably damaging 0.97
R0021:Abcc5 UTSW 16 20378661 nonsense probably null
R0021:Abcc5 UTSW 16 20378661 nonsense probably null
R0220:Abcc5 UTSW 16 20369102 missense probably benign
R0281:Abcc5 UTSW 16 20422400 missense probably damaging 1.00
R0401:Abcc5 UTSW 16 20376558 missense probably benign 0.09
R0448:Abcc5 UTSW 16 20399937 missense probably damaging 1.00
R0477:Abcc5 UTSW 16 20368569 missense possibly damaging 0.51
R0477:Abcc5 UTSW 16 20398885 missense probably damaging 0.96
R0601:Abcc5 UTSW 16 20404559 splice site probably benign
R0648:Abcc5 UTSW 16 20365882 missense possibly damaging 0.90
R0709:Abcc5 UTSW 16 20376592 missense possibly damaging 0.91
R1144:Abcc5 UTSW 16 20422438 utr 5 prime probably benign
R1552:Abcc5 UTSW 16 20398867 missense probably damaging 0.99
R1625:Abcc5 UTSW 16 20365817 missense probably damaging 0.99
R1748:Abcc5 UTSW 16 20333588 missense probably benign 0.01
R1789:Abcc5 UTSW 16 20365951 missense probably damaging 1.00
R1801:Abcc5 UTSW 16 20338887 missense probably benign 0.43
R1909:Abcc5 UTSW 16 20376509 critical splice donor site probably null
R2046:Abcc5 UTSW 16 20399817 missense possibly damaging 0.90
R2203:Abcc5 UTSW 16 20405882 missense possibly damaging 0.91
R3031:Abcc5 UTSW 16 20375113 missense probably damaging 0.99
R3417:Abcc5 UTSW 16 20405552 splice site probably benign
R3708:Abcc5 UTSW 16 20372180 missense probably benign 0.30
R3731:Abcc5 UTSW 16 20398934 nonsense probably null
R3829:Abcc5 UTSW 16 20365865 missense probably benign 0.00
R3847:Abcc5 UTSW 16 20372156 missense probably benign 0.12
R3850:Abcc5 UTSW 16 20372156 missense probably benign 0.12
R3955:Abcc5 UTSW 16 20405543 missense probably damaging 0.97
R4072:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4432:Abcc5 UTSW 16 20368187 splice site probably null
R4433:Abcc5 UTSW 16 20368187 splice site probably null
R4505:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4506:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4715:Abcc5 UTSW 16 20398876 missense probably damaging 1.00
R4739:Abcc5 UTSW 16 20399626 missense probably damaging 1.00
R4866:Abcc5 UTSW 16 20422432 start codon destroyed probably null 1.00
R4905:Abcc5 UTSW 16 20399928 missense probably damaging 1.00
R4907:Abcc5 UTSW 16 20376546 missense possibly damaging 0.86
R5088:Abcc5 UTSW 16 20376662 missense probably damaging 1.00
R5232:Abcc5 UTSW 16 20338922 missense probably damaging 0.96
R5559:Abcc5 UTSW 16 20338886 missense probably damaging 1.00
R5647:Abcc5 UTSW 16 20399847 missense probably damaging 1.00
R5861:Abcc5 UTSW 16 20399894 missense probably damaging 1.00
R6190:Abcc5 UTSW 16 20392779 missense probably benign 0.02
R6213:Abcc5 UTSW 16 20400012 missense probably damaging 1.00
R6511:Abcc5 UTSW 16 20376594 missense probably damaging 0.99
R6732:Abcc5 UTSW 16 20404684 missense probably benign 0.01
R6815:Abcc5 UTSW 16 20333630 missense probably damaging 1.00
R6913:Abcc5 UTSW 16 20378744 missense possibly damaging 0.73
R6945:Abcc5 UTSW 16 20400009 missense probably benign
R7167:Abcc5 UTSW 16 20405501 missense possibly damaging 0.70
R7276:Abcc5 UTSW 16 20376508 splice site probably null
R7318:Abcc5 UTSW 16 20392543 missense probably benign 0.01
R7380:Abcc5 UTSW 16 20397034 missense possibly damaging 0.84
R7419:Abcc5 UTSW 16 20422423 missense possibly damaging 0.57
R7475:Abcc5 UTSW 16 20399989 missense probably benign 0.04
R7567:Abcc5 UTSW 16 20405510 missense probably damaging 1.00
R7601:Abcc5 UTSW 16 20375132 nonsense probably null
R7623:Abcc5 UTSW 16 20344696 missense possibly damaging 0.95
R7682:Abcc5 UTSW 16 20368053 missense probably damaging 1.00
R8128:Abcc5 UTSW 16 20365723 missense probably damaging 0.98
R8327:Abcc5 UTSW 16 20422318 missense probably benign 0.00
R8518:Abcc5 UTSW 16 20404648 missense possibly damaging 0.80
X0022:Abcc5 UTSW 16 20392587 missense probably damaging 1.00
X0053:Abcc5 UTSW 16 20364042 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCTTCCACAGGAGAAGGAGCAG -3'
(R):5'- AATGGGCAGCCAAAGCATC -3'

Sequencing Primer
(F):5'- CAAAAGTGTGGTTGTGGGAAC -3'
(R):5'- AGCCAAAGCATCTCTGGTTG -3'
Posted On2019-10-07