Incidental Mutation 'R7451:Synj2'
ID577757
Institutional Source Beutler Lab
Gene Symbol Synj2
Ensembl Gene ENSMUSG00000023805
Gene Namesynaptojanin 2
SynonymsSJ2
MMRRC Submission
Accession Numbers

Genbank: NM_001113353.1, NM_001113352.1, NM_011523.2, NM_001113351.1

Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R7451 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location5941280-6044290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6029791 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1098 (N1098K)
Ref Sequence ENSEMBL: ENSMUSP00000111457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061091] [ENSMUST00000080283] [ENSMUST00000115785] [ENSMUST00000115790] [ENSMUST00000115791] [ENSMUST00000126881] [ENSMUST00000134767] [ENSMUST00000142409] [ENSMUST00000154114]
Predicted Effect probably benign
Transcript: ENSMUST00000061091
AA Change: N1013K

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000060382
Gene: ENSMUSG00000023805
AA Change: N1013K

DomainStartEndE-ValueType
Pfam:Syja_N 1 263 2.5e-72 PFAM
Blast:IPPc 394 423 3e-6 BLAST
IPPc 443 785 3.72e-128 SMART
DUF1866 778 923 1.04e-73 SMART
low complexity region 926 940 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080283
SMART Domains Protein: ENSMUSP00000079164
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 60 348 5.5e-78 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1167 1179 N/A INTRINSIC
low complexity region 1217 1234 N/A INTRINSIC
low complexity region 1263 1277 N/A INTRINSIC
low complexity region 1293 1306 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115785
SMART Domains Protein: ENSMUSP00000111451
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
PDB:3LWT|X 9 171 4e-12 PDB
Blast:IPPc 163 192 2e-6 BLAST
IPPc 212 554 3.72e-128 SMART
DUF1866 547 692 1.04e-73 SMART
low complexity region 695 709 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
low complexity region 851 863 N/A INTRINSIC
low complexity region 901 918 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
low complexity region 977 990 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115790
AA Change: N1013K

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111456
Gene: ENSMUSG00000023805
AA Change: N1013K

DomainStartEndE-ValueType
Pfam:Syja_N 1 263 3e-72 PFAM
Blast:IPPc 394 423 3e-6 BLAST
IPPc 443 785 3.72e-128 SMART
DUF1866 778 923 1.04e-73 SMART
low complexity region 926 940 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1177 1194 N/A INTRINSIC
low complexity region 1223 1237 N/A INTRINSIC
low complexity region 1253 1266 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115791
AA Change: N1098K

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000111457
Gene: ENSMUSG00000023805
AA Change: N1098K

DomainStartEndE-ValueType
Pfam:Syja_N 61 343 8.5e-67 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1097 1112 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1262 1279 N/A INTRINSIC
low complexity region 1308 1322 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126881
SMART Domains Protein: ENSMUSP00000115371
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
DUF1866 16 161 1.04e-73 SMART
low complexity region 164 178 N/A INTRINSIC
low complexity region 203 214 N/A INTRINSIC
low complexity region 320 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134767
Predicted Effect probably benign
Transcript: ENSMUST00000142409
SMART Domains Protein: ENSMUSP00000120006
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 108 2.5e-28 PFAM
Blast:IPPc 239 268 2e-6 BLAST
IPPc 288 630 3.72e-128 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154114
SMART Domains Protein: ENSMUSP00000122316
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
IPPc 6 348 3.72e-128 SMART
DUF1866 341 486 1.04e-73 SMART
low complexity region 489 503 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the inositol-polyphosphate 5-phosphatase family. The encoded protein interacts with the ras-related C3 botulinum toxin substrate 1, which causes translocation of the encoded protein to the plasma membrane where it inhibits clathrin-mediated endocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for an ENU-induced allele show progressive hearing loss and cochlear hair cell degeneration associated with fusion of stereocilia followed by total loss of hair bundles and cochlear ganglion degeneration. No vestibular dysfunction or other behavioral deficits are observed. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,457 N147I possibly damaging Het
4932438A13Rik G T 3: 37,022,807 probably null Het
Abcb6 A G 1: 75,172,153 I794T probably damaging Het
Abcc5 T A 16: 20,375,070 H767L probably damaging Het
Adgrb2 A T 4: 130,014,557 M1031L probably damaging Het
Akna T A 4: 63,378,667 M891L probably benign Het
Aloxe3 C A 11: 69,142,920 T620K possibly damaging Het
Amph A G 13: 19,077,368 Y63C probably damaging Het
Asprv1 A G 6: 86,628,948 I259V probably benign Het
Atp7b C T 8: 22,014,684 W652* probably null Het
Atp8a2 C T 14: 59,791,181 D946N probably null Het
BC024063 T A 10: 82,108,742 N65K probably benign Het
Bean1 A T 8: 104,213,996 M154L probably benign Het
Cacna1c C T 6: 118,594,020 V2181M unknown Het
Cacna1g A G 11: 94,429,075 I1425T probably damaging Het
Caskin2 A G 11: 115,812,155 probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfd T A 10: 79,891,528 V43E probably damaging Het
Chd9 GCCCC GCCC 8: 91,033,790 probably null Het
Chd9 T A 8: 91,033,818 S2064T probably benign Het
Cpsf2 T G 12: 102,000,792 V646G possibly damaging Het
Ctif T C 18: 75,519,803 D461G possibly damaging Het
Cyp3a41a T A 5: 145,699,740 E414D probably benign Het
Dagla A G 19: 10,253,355 V544A probably damaging Het
Dhx57 A T 17: 80,247,113 V1228E probably damaging Het
Eif2b3 T A 4: 117,052,796 L176* probably null Het
Fbxw26 T A 9: 109,732,623 I168L probably benign Het
Flt3 T A 5: 147,349,667 Y703F probably damaging Het
Frmpd1 C T 4: 45,279,558 P761L probably benign Het
Gabrd A G 4: 155,388,459 V89A possibly damaging Het
Galnt14 A T 17: 73,574,809 H98Q probably benign Het
Gli3 T C 13: 15,726,291 V1421A possibly damaging Het
Gprin2 A G 14: 34,195,805 S3P probably damaging Het
Ifi211 T G 1: 173,899,492 D362A probably damaging Het
Lars G T 18: 42,202,550 T1167K probably benign Het
Lce1b T C 3: 92,655,900 S109G unknown Het
Lrp2 T G 2: 69,513,333 E894A probably damaging Het
Mamdc4 A G 2: 25,564,461 V1081A possibly damaging Het
Mcub T C 3: 129,917,103 S227G possibly damaging Het
Mki67 A G 7: 135,699,351 I1318T probably benign Het
Mybl2 C T 2: 163,072,706 T248I possibly damaging Het
Myo9b A T 8: 71,352,188 H1441L probably benign Het
Nav2 T A 7: 49,552,829 probably null Het
Neb C T 2: 52,201,454 V5339I probably benign Het
Nktr T A 9: 121,729,656 S88T probably damaging Het
Nup155 C T 15: 8,145,607 Q963* probably null Het
Oas1c A C 5: 120,802,142 L320V possibly damaging Het
Olfr108 C A 17: 37,446,305 S261R probably damaging Het
Olfr1254 A G 2: 89,789,109 M81T probably benign Het
Olfr1338 C T 4: 118,753,687 A286T probably benign Het
Olfr149 G A 9: 39,702,127 T214I probably damaging Het
Olfr325 A G 11: 58,581,690 Y282C probably damaging Het
Olfr548-ps1 T C 7: 102,542,254 I106T probably benign Het
Pcdhga7 A G 18: 37,716,004 S355G possibly damaging Het
Pde11a C T 2: 76,022,773 V834I possibly damaging Het
Pdzrn4 A T 15: 92,770,067 D700V possibly damaging Het
Pif1 C A 9: 65,588,348 P180Q probably benign Het
Pkig G T 2: 163,721,163 E5* probably null Het
Pla2r1 T A 2: 60,535,002 M75L probably damaging Het
Pllp T C 8: 94,676,243 S157G probably damaging Het
Ppfia1 A T 7: 144,508,210 H566Q probably benign Het
Ptpn13 A G 5: 103,527,095 D646G probably benign Het
Rab11fip5 T A 6: 85,341,556 T784S probably benign Het
Rad51ap2 T G 12: 11,457,981 S635A probably benign Het
Ranbp17 A T 11: 33,284,114 probably null Het
Rce1 C T 19: 4,625,053 G111D probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rimbp2 C T 5: 128,788,371 V631I probably benign Het
Scai T C 2: 39,125,136 T94A probably damaging Het
Sfmbt1 G A 14: 30,816,811 A796T probably benign Het
Slc6a11 C A 6: 114,245,683 Y546* probably null Het
Slc7a2 T C 8: 40,912,649 S506P probably damaging Het
Tmem177 G A 1: 119,910,241 A236V probably damaging Het
Togaram1 T A 12: 64,996,975 D1249E probably damaging Het
Trav17 A T 14: 53,806,639 M1L probably damaging Het
Trim25 C A 11: 89,015,737 A433D possibly damaging Het
Trim69 T C 2: 122,168,027 F160S probably benign Het
Trio A T 15: 27,747,913 V1407E probably benign Het
Trpm7 A T 2: 126,826,737 M753K probably damaging Het
Ttc12 G T 9: 49,471,879 A75E probably benign Het
Uchl4 A T 9: 64,235,731 I165L probably benign Het
Uvrag A T 7: 99,140,913 L13Q unknown Het
Wwc2 G A 8: 47,864,575 R656W not run Het
Other mutations in Synj2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Synj2 APN 17 6037926 missense possibly damaging 0.48
IGL01399:Synj2 APN 17 6009771 missense probably damaging 1.00
IGL01793:Synj2 APN 17 6027225 nonsense probably null
IGL01793:Synj2 APN 17 6038046 missense probably benign 0.01
IGL02096:Synj2 APN 17 5990353 missense probably damaging 1.00
IGL02115:Synj2 APN 17 6017590 missense probably damaging 1.00
IGL02222:Synj2 APN 17 6037480 missense probably benign 0.04
IGL02478:Synj2 APN 17 6037924 missense probably benign 0.00
IGL02634:Synj2 APN 17 6029760 missense probably damaging 1.00
IGL02652:Synj2 APN 17 6017593 missense probably damaging 1.00
IGL02681:Synj2 APN 17 5990336 missense probably damaging 1.00
IGL02719:Synj2 APN 17 5996917 missense probably benign 0.02
IGL03253:Synj2 APN 17 6003159 unclassified probably null
IGL03365:Synj2 APN 17 6019404 missense probably damaging 1.00
I2288:Synj2 UTSW 17 6022267 splice site probably benign
I2289:Synj2 UTSW 17 6022267 splice site probably benign
R0389:Synj2 UTSW 17 6029783 missense probably benign 0.35
R0433:Synj2 UTSW 17 6033848 missense probably damaging 1.00
R0530:Synj2 UTSW 17 6008105 missense possibly damaging 0.88
R0539:Synj2 UTSW 17 5996888 start codon destroyed probably null 0.63
R0556:Synj2 UTSW 17 6037955 nonsense probably null
R1263:Synj2 UTSW 17 6019359 missense probably damaging 0.99
R1443:Synj2 UTSW 17 6023665 missense probably damaging 0.99
R1450:Synj2 UTSW 17 6027324 splice site probably benign
R1532:Synj2 UTSW 17 6033919 missense probably benign 0.00
R1542:Synj2 UTSW 17 6025017 missense probably benign 0.01
R1809:Synj2 UTSW 17 6026551 missense possibly damaging 0.95
R1875:Synj2 UTSW 17 6028550 missense possibly damaging 0.69
R1897:Synj2 UTSW 17 6022137 nonsense probably null
R1928:Synj2 UTSW 17 5990267 missense probably damaging 0.99
R2008:Synj2 UTSW 17 5996946 missense probably damaging 1.00
R2060:Synj2 UTSW 17 6037480 missense probably benign 0.04
R2109:Synj2 UTSW 17 6013691 missense probably benign 0.00
R2332:Synj2 UTSW 17 6023794 missense probably damaging 0.99
R2413:Synj2 UTSW 17 6028574 missense probably damaging 1.00
R3684:Synj2 UTSW 17 6028443 missense probably damaging 0.97
R4111:Synj2 UTSW 17 6007965 missense probably benign 0.02
R4113:Synj2 UTSW 17 6007965 missense probably benign 0.02
R4654:Synj2 UTSW 17 6013538 missense probably damaging 1.00
R4797:Synj2 UTSW 17 6033888 missense probably damaging 1.00
R4812:Synj2 UTSW 17 6010664 missense probably damaging 1.00
R4873:Synj2 UTSW 17 5988068 intron probably benign
R4875:Synj2 UTSW 17 5988068 intron probably benign
R5110:Synj2 UTSW 17 6037715 missense probably benign 0.06
R5205:Synj2 UTSW 17 5941518 missense probably damaging 1.00
R5504:Synj2 UTSW 17 6036475 missense possibly damaging 0.85
R5593:Synj2 UTSW 17 6038115 makesense probably null
R5690:Synj2 UTSW 17 6035527 missense probably benign 0.00
R5870:Synj2 UTSW 17 6037853 missense probably benign 0.00
R6084:Synj2 UTSW 17 6017614 missense probably damaging 0.98
R6084:Synj2 UTSW 17 6038098 missense probably damaging 1.00
R6158:Synj2 UTSW 17 5986212 missense probably benign 0.00
R6159:Synj2 UTSW 17 5986052 missense probably damaging 1.00
R6160:Synj2 UTSW 17 6008061 missense possibly damaging 0.92
R6278:Synj2 UTSW 17 5975874 missense probably damaging 1.00
R6406:Synj2 UTSW 17 6019571 intron probably benign
R6531:Synj2 UTSW 17 6033839 missense probably damaging 1.00
R6729:Synj2 UTSW 17 5986014 start codon destroyed probably null 1.00
R6774:Synj2 UTSW 17 6038015 missense possibly damaging 0.87
R6792:Synj2 UTSW 17 5990290 missense probably benign 0.01
R6844:Synj2 UTSW 17 5975806 missense probably damaging 0.96
R6865:Synj2 UTSW 17 6017569 nonsense probably null
R7178:Synj2 UTSW 17 6026479 missense possibly damaging 0.95
R7286:Synj2 UTSW 17 6037945 missense possibly damaging 0.79
R7403:Synj2 UTSW 17 6037730 missense possibly damaging 0.76
R7501:Synj2 UTSW 17 5990239 missense possibly damaging 0.79
R7730:Synj2 UTSW 17 6016287 missense probably benign 0.33
R7799:Synj2 UTSW 17 6037823 missense probably benign 0.10
R7804:Synj2 UTSW 17 6019534 missense unknown
R7841:Synj2 UTSW 17 6044144 missense unknown
R7924:Synj2 UTSW 17 6044144 missense unknown
Predicted Primers PCR Primer
(F):5'- GCATCCCATAGCACTTCTGC -3'
(R):5'- CCAAACAGAGCATGCCTTATAG -3'

Sequencing Primer
(F):5'- ATAGCACTTCTGCCTACTACAGTATG -3'
(R):5'- CAGAGCATGCCTTATAGTTAGACAAC -3'
Posted On2019-10-07