Incidental Mutation 'R7452:Dnah7c'
ID577768
Institutional Source Beutler Lab
Gene Symbol Dnah7c
Ensembl Gene ENSMUSG00000101337
Gene Namedynein, axonemal, heavy chain 7C
SynonymsDnahc7c
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.327) question?
Stock #R7452 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location46425592-46807476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46647036 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1817 (M1817L)
Ref Sequence ENSEMBL: ENSMUSP00000140430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000189749]
Predicted Effect possibly damaging
Transcript: ENSMUST00000189749
AA Change: M1817L

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140430
Gene: ENSMUSG00000101337
AA Change: M1817L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 37 48 N/A INTRINSIC
coiled coil region 714 746 N/A INTRINSIC
Pfam:DHC_N2 754 1167 2.2e-138 PFAM
AAA 1320 1459 4e-3 SMART
Blast:AAA 1601 1829 4e-87 BLAST
AAA 1968 2116 8.7e-4 SMART
Pfam:AAA_8 2303 2574 6.2e-73 PFAM
Pfam:MT 2586 2935 5.4e-52 PFAM
Pfam:AAA_9 2953 3183 7.4e-63 PFAM
Pfam:Dynein_heavy 3312 4021 1.3e-250 PFAM
Meta Mutation Damage Score 0.0839 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,671 S595P probably benign Het
A2m C A 6: 121,641,332 Q195K probably damaging Het
Abcg4 C T 9: 44,279,600 G249R probably damaging Het
Actn1 T C 12: 80,183,602 T293A probably benign Het
Adamts5 T A 16: 85,877,981 T432S probably benign Het
Adh5 A G 3: 138,454,745 T347A probably benign Het
Agbl5 A G 5: 30,893,391 D432G probably damaging Het
Ank3 A G 10: 69,899,051 T797A possibly damaging Het
Aoc1 T G 6: 48,908,790 V743G probably benign Het
Arap2 A T 5: 62,676,549 S858R probably benign Het
Arid1a A C 4: 133,753,127 V162G possibly damaging Het
Armc9 A G 1: 86,213,092 D588G possibly damaging Het
Art3 A G 5: 92,392,680 Y94C probably damaging Het
Btaf1 T A 19: 36,969,127 D444E probably damaging Het
Cav2 A G 6: 17,282,076 H111R probably damaging Het
Ccdc148 A G 2: 58,827,584 L469P probably damaging Het
Celsr2 T A 3: 108,413,090 E802V possibly damaging Het
Cfap57 T C 4: 118,595,784 D574G probably damaging Het
Chd7 A C 4: 8,854,731 D2024A probably benign Het
Corin T A 5: 72,435,247 D269V possibly damaging Het
Cyp4a12a A T 4: 115,327,598 I359F probably damaging Het
Defb6 T C 8: 19,225,524 L7P probably damaging Het
Dock3 A G 9: 106,989,465 F682S probably damaging Het
Enpep T A 3: 129,271,403 Y879F possibly damaging Het
Enpp2 T C 15: 54,866,736 N462S probably damaging Het
Ephb3 T C 16: 21,217,357 probably null Het
F7 C T 8: 13,035,215 H414Y probably benign Het
Fbn1 T C 2: 125,505,455 H50R possibly damaging Het
Fig4 T C 10: 41,240,637 D586G possibly damaging Het
Fryl A G 5: 73,023,988 L2825P probably damaging Het
Gal3st2 T A 1: 93,872,518 H30Q possibly damaging Het
Gm12886 G A 4: 121,417,474 Q70* probably null Het
Gm8104 A C 14: 43,110,044 T190P probably benign Het
Hps3 A T 3: 20,011,428 N749K probably damaging Het
Hr A G 14: 70,571,486 T1101A probably damaging Het
Htatip2 T A 7: 49,773,326 S210T probably benign Het
Ift80 T C 3: 68,994,282 probably null Het
Iqgap1 A G 7: 80,760,829 V212A possibly damaging Het
Itih5 A G 2: 10,238,796 E448G probably damaging Het
Kdm5b T C 1: 134,624,948 C1221R probably damaging Het
Lrrc72 T C 12: 36,212,693 Y52C probably benign Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mdn1 T C 4: 32,739,030 I3617T possibly damaging Het
Mtpap T A 18: 4,379,705 H98Q possibly damaging Het
Nemf A T 12: 69,337,959 probably null Het
Neto1 A T 18: 86,498,931 I458L probably benign Het
Nfam1 T A 15: 83,014,962 M128L probably benign Het
Olfr1279 A G 2: 111,306,921 T239A probably damaging Het
Olfr1383 C A 11: 49,524,381 H219Q probably benign Het
Olfr501-ps1 C T 7: 108,508,593 T179I unknown Het
Olfr914 A T 9: 38,607,088 I208F probably benign Het
P2ry14 C T 3: 59,116,045 G7D probably benign Het
Pde11a A G 2: 76,136,414 Y564H probably damaging Het
Pex5l C T 3: 33,004,318 V262I probably benign Het
Poli A G 18: 70,508,978 V717A possibly damaging Het
Prdm14 A T 1: 13,125,559 W93R probably damaging Het
Rbm46 T C 3: 82,864,121 M396V probably benign Het
Rcor2 T C 19: 7,271,222 V212A probably benign Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Skp2 T A 15: 9,113,832 Q366L probably damaging Het
Slc13a3 A T 2: 165,427,114 S312T probably benign Het
Sstr1 T C 12: 58,213,356 L255P probably damaging Het
Steap3 T C 1: 120,227,855 E458G possibly damaging Het
Sv2b T A 7: 75,147,713 D311V probably damaging Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a A G 8: 70,177,488 D108G probably damaging Het
Traf5 T A 1: 191,999,831 I47F Het
Trp53bp2 C T 1: 182,446,568 Q95* probably null Het
Ttn G T 2: 76,877,143 probably null Het
Usf3 T C 16: 44,220,034 S1626P probably benign Het
Usp3 T C 9: 66,566,898 R33G probably benign Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Other mutations in Dnah7c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00559:Dnah7c APN 1 46807289 missense possibly damaging 0.72
IGL02958:Dnah7c APN 1 46657111 missense probably damaging 1.00
IGL03035:Dnah7c APN 1 46524117 missense probably benign 0.37
IGL03161:Dnah7c APN 1 46467296 missense probably benign 0.20
IGL03178:Dnah7c APN 1 46467365 missense probably benign
IGL03052:Dnah7c UTSW 1 46632149 missense probably damaging 1.00
R0751:Dnah7c UTSW 1 46465905 missense probably benign
R1029:Dnah7c UTSW 1 46612721 missense probably damaging 1.00
R3104:Dnah7c UTSW 1 46798279 missense probably damaging 0.97
R3977:Dnah7c UTSW 1 46628911 missense possibly damaging 0.75
R4003:Dnah7c UTSW 1 46681817 missense probably damaging 1.00
R4133:Dnah7c UTSW 1 46665990 missense probably benign 0.01
R4303:Dnah7c UTSW 1 46748578 missense probably damaging 1.00
R4329:Dnah7c UTSW 1 46649281 missense probably benign 0.33
R4434:Dnah7c UTSW 1 46666282 missense probably damaging 1.00
R4457:Dnah7c UTSW 1 46740621 missense probably damaging 1.00
R4470:Dnah7c UTSW 1 46748635 missense possibly damaging 0.56
R4507:Dnah7c UTSW 1 46766611 missense probably damaging 1.00
R4527:Dnah7c UTSW 1 46532931 missense probably benign 0.34
R4571:Dnah7c UTSW 1 46533216 missense probably damaging 0.99
R4589:Dnah7c UTSW 1 46514583 nonsense probably null
R4731:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4732:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4733:Dnah7c UTSW 1 46770173 missense probably damaging 1.00
R4747:Dnah7c UTSW 1 46533168 missense probably damaging 1.00
R4845:Dnah7c UTSW 1 46793532 missense probably damaging 1.00
R4873:Dnah7c UTSW 1 46688925 missense probably benign
R4875:Dnah7c UTSW 1 46688925 missense probably benign
R4916:Dnah7c UTSW 1 46595008 missense probably damaging 1.00
R5241:Dnah7c UTSW 1 46530500 missense probably benign
R5279:Dnah7c UTSW 1 46519269 missense probably benign 0.14
R5327:Dnah7c UTSW 1 46665568 missense probably benign 0.05
R5546:Dnah7c UTSW 1 46666317 missense probably damaging 1.00
R5605:Dnah7c UTSW 1 46798235 missense possibly damaging 0.84
R5637:Dnah7c UTSW 1 46760361 splice site probably null
R5639:Dnah7c UTSW 1 46739668 missense probably benign
R5663:Dnah7c UTSW 1 46535148 missense probably damaging 1.00
R5718:Dnah7c UTSW 1 46748666 missense possibly damaging 0.47
R5759:Dnah7c UTSW 1 46615367 missense probably damaging 1.00
R5771:Dnah7c UTSW 1 46639665 missense probably benign 0.00
R5784:Dnah7c UTSW 1 46524068 missense possibly damaging 0.80
R5800:Dnah7c UTSW 1 46647015 missense probably benign 0.01
R5933:Dnah7c UTSW 1 46519215 missense probably damaging 1.00
R5948:Dnah7c UTSW 1 46672497 missense probably benign 0.21
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6034:Dnah7c UTSW 1 46457258 missense probably benign 0.00
R6487:Dnah7c UTSW 1 46769124 missense probably damaging 1.00
R6536:Dnah7c UTSW 1 46658290 missense probably benign 0.00
R6614:Dnah7c UTSW 1 46649340 missense probably benign
R6614:Dnah7c UTSW 1 46649351 missense probably benign
R6615:Dnah7c UTSW 1 46515439 missense probably benign 0.01
R6615:Dnah7c UTSW 1 46649340 missense probably benign
R6615:Dnah7c UTSW 1 46649351 missense probably benign
R6649:Dnah7c UTSW 1 46649340 missense probably benign
R6649:Dnah7c UTSW 1 46649351 missense probably benign
R6650:Dnah7c UTSW 1 46649340 missense probably benign
R6650:Dnah7c UTSW 1 46649351 missense probably benign
R6651:Dnah7c UTSW 1 46649340 missense probably benign
R6651:Dnah7c UTSW 1 46649351 missense probably benign
R6653:Dnah7c UTSW 1 46649340 missense probably benign
R6653:Dnah7c UTSW 1 46649351 missense probably benign
R6714:Dnah7c UTSW 1 46740806 missense probably damaging 0.99
R6729:Dnah7c UTSW 1 46672521 missense possibly damaging 0.46
R6760:Dnah7c UTSW 1 46649340 missense probably benign
R6760:Dnah7c UTSW 1 46649351 missense probably benign
R6763:Dnah7c UTSW 1 46628890 missense possibly damaging 0.60
R6866:Dnah7c UTSW 1 46657243 missense probably damaging 1.00
R6880:Dnah7c UTSW 1 46527671 missense probably damaging 0.97
R6988:Dnah7c UTSW 1 46666213 missense possibly damaging 0.68
R6995:Dnah7c UTSW 1 46455813 missense probably benign 0.07
R7007:Dnah7c UTSW 1 46532750 missense probably benign 0.04
R7086:Dnah7c UTSW 1 46750125 missense probably benign 0.00
R7128:Dnah7c UTSW 1 46527485 missense probably benign
R7131:Dnah7c UTSW 1 46681772 missense probably benign 0.00
R7135:Dnah7c UTSW 1 46533208 missense probably damaging 1.00
R7171:Dnah7c UTSW 1 46680738 missense probably damaging 0.99
R7176:Dnah7c UTSW 1 46430809 missense probably benign 0.00
R7221:Dnah7c UTSW 1 46455777 missense possibly damaging 0.87
R7310:Dnah7c UTSW 1 46596967 missense possibly damaging 0.94
R7319:Dnah7c UTSW 1 46780775 missense probably benign 0.31
R7319:Dnah7c UTSW 1 46784448 missense possibly damaging 0.95
R7404:Dnah7c UTSW 1 46666063 missense possibly damaging 0.52
R7515:Dnah7c UTSW 1 46457290 missense probably benign
R7534:Dnah7c UTSW 1 46770067 missense probably damaging 0.98
R7542:Dnah7c UTSW 1 46784498 missense probably benign 0.00
R7605:Dnah7c UTSW 1 46632310 missense probably damaging 1.00
R7643:Dnah7c UTSW 1 46602813 missense probably benign
R7770:Dnah7c UTSW 1 46626300 intron probably null
R7884:Dnah7c UTSW 1 46791769 missense probably benign 0.23
R7899:Dnah7c UTSW 1 46514701 missense probably benign 0.00
R8025:Dnah7c UTSW 1 46457296 missense probably benign 0.01
R8057:Dnah7c UTSW 1 46688952 missense possibly damaging 0.52
R8191:Dnah7c UTSW 1 46607458 missense possibly damaging 0.56
R8255:Dnah7c UTSW 1 46659429 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46467302 missense probably benign 0.00
Z1176:Dnah7c UTSW 1 46615281 missense probably damaging 1.00
Z1176:Dnah7c UTSW 1 46639665 missense probably benign
Z1176:Dnah7c UTSW 1 46646992 critical splice acceptor site probably null
Z1176:Dnah7c UTSW 1 46760316 missense possibly damaging 0.95
Z1177:Dnah7c UTSW 1 46654103 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGTGGTAGTCAGTGTACAGAAGAC -3'
(R):5'- TGGGTCTCATTGATTGGACGAC -3'

Sequencing Primer
(F):5'- GACATGAATGTAGACCTCAGATTTCC -3'
(R):5'- AATGCCTTACCTCCAGCA -3'
Posted On2019-10-07