Incidental Mutation 'R0629:Itgb8'
ID57777
Institutional Source Beutler Lab
Gene Symbol Itgb8
Ensembl Gene ENSMUSG00000025321
Gene Nameintegrin beta 8
Synonyms4832412O06Rik
MMRRC Submission 038818-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0629 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location119158022-119238802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 119202481 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 105 (H105P)
Ref Sequence ENSEMBL: ENSMUSP00000026360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026360]
Predicted Effect probably benign
Transcript: ENSMUST00000026360
AA Change: H105P

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026360
Gene: ENSMUSG00000025321
AA Change: H105P

DomainStartEndE-ValueType
Blast:INB 1 44 9e-8 BLAST
PSI 46 95 6.65e-9 SMART
INB 54 469 4.31e-237 SMART
VWA 146 352 2.15e-1 SMART
Blast:INB 494 532 9e-12 BLAST
EGF 551 583 1.53e1 SMART
transmembrane domain 680 702 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151023
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the integrin beta chain family and encodes a single-pass type I membrane protein with a VWFA domain and four cysteine-rich repeats. This protein noncovalently binds to an alpha subunit to form a heterodimeric integrin complex. In general, integrin complexes mediate cell-cell and cell-extracellular matrix interactions and this complex plays a role in human airway epithelial proliferation. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene either die before E11.5 as a result of circulatory abnormalities in the placenta or die within the first for days after birth and display intracerebral hemorrhaging. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Itgb8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Itgb8 APN 12 119189826 missense probably damaging 0.99
IGL01859:Itgb8 APN 12 119189945 missense probably damaging 1.00
IGL02555:Itgb8 APN 12 119189881 missense probably damaging 1.00
IGL02665:Itgb8 APN 12 119166865 splice site probably benign
IGL02732:Itgb8 APN 12 119163353 missense probably benign 0.09
R0090:Itgb8 UTSW 12 119202563 missense probably benign 0.00
R0245:Itgb8 UTSW 12 119190555 missense probably damaging 1.00
R1158:Itgb8 UTSW 12 119202496 missense probably damaging 1.00
R1355:Itgb8 UTSW 12 119171003 missense probably benign 0.03
R1370:Itgb8 UTSW 12 119171003 missense probably benign 0.03
R1604:Itgb8 UTSW 12 119202530 missense probably damaging 1.00
R1689:Itgb8 UTSW 12 119170820 missense probably benign 0.38
R1782:Itgb8 UTSW 12 119192118 missense probably damaging 0.99
R1789:Itgb8 UTSW 12 119202455 missense probably benign
R2113:Itgb8 UTSW 12 119190612 missense probably damaging 1.00
R2301:Itgb8 UTSW 12 119202455 missense probably benign
R3696:Itgb8 UTSW 12 119177011 missense probably damaging 0.99
R3797:Itgb8 UTSW 12 119163469 missense possibly damaging 0.92
R3911:Itgb8 UTSW 12 119168005 missense possibly damaging 0.65
R4904:Itgb8 UTSW 12 119170871 missense probably benign 0.00
R5391:Itgb8 UTSW 12 119170741 missense probably damaging 1.00
R5395:Itgb8 UTSW 12 119170741 missense probably damaging 1.00
R5444:Itgb8 UTSW 12 119237838 utr 5 prime probably benign
R5461:Itgb8 UTSW 12 119168005 missense probably benign 0.28
R5610:Itgb8 UTSW 12 119170694 missense probably damaging 1.00
R5669:Itgb8 UTSW 12 119190628 missense probably damaging 1.00
R5877:Itgb8 UTSW 12 119202536 missense probably benign 0.37
R6581:Itgb8 UTSW 12 119163215 missense probably benign 0.41
R6597:Itgb8 UTSW 12 119173398 missense possibly damaging 0.94
R6631:Itgb8 UTSW 12 119180977 nonsense probably null
R6971:Itgb8 UTSW 12 119190631 missense probably damaging 1.00
R7124:Itgb8 UTSW 12 119202424 nonsense probably null
R7246:Itgb8 UTSW 12 119168050 missense probably damaging 1.00
R7282:Itgb8 UTSW 12 119237708 missense probably benign 0.00
R7299:Itgb8 UTSW 12 119202461 missense probably benign 0.00
R7340:Itgb8 UTSW 12 119192204 missense probably benign 0.45
R7373:Itgb8 UTSW 12 119202475 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTAGACTTCAGCTACTCTGCTGTTTGG -3'
(R):5'- GGGTTTCTTGAAACATACGGCACAC -3'

Sequencing Primer
(F):5'- TGGTTGTATCATATTAACTGTGAGC -3'
(R):5'- TCAGGTGGATCAGGAAGTGA -3'
Posted On2013-07-11