Mutagenetix > Incidental Mutation

Incidental Mutation 'R7452:Traf5'

577774

Institutional Source

Beutler Lab

Gene Symbol

Traf5

Ensembl Gene

ENSMUSG00000026637

Gene Name

TNF receptor-associated factor 5

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7452 (G1)

Quality Score

184.009

Status

Validated

Chromosome

Chromosomal Location

191997205-192092559 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 191999831 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 47 (I47F)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085573]

AlphaFold

P70191

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085573
AA Change: I350F

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000082710
Gene: ENSMUSG00000026637
AA Change: I350F

Domain	Start	End	E-Value	Type
RING	45	84	1.74e-4	SMART
Pfam:zf-TRAF	128	183	4.8e-21	PFAM
Pfam:zf-TRAF	183	241	4.2e-19	PFAM
MATH	402	525	2.42e-21	SMART

Predicted Effect

Meta Mutation Damage Score

0.0613

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The scaffold protein encoded by this gene is a member of the tumor necrosis factor receptor-associated factor (TRAF) protein family and contains a meprin and TRAF homology (MATH) domain, a RING-type zinc finger, and two TRAF-type zinc fingers. TRAF proteins are associated with, and mediate signal transduction from members of the TNF receptor superfamily. This protein is one of the components of a multiple protein complex which binds to tumor necrosis factor (TNF) receptor cytoplasmic domains and mediates TNF-induced activation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice show defects in lymphocyte activation but are otherwise viable and develop normally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	G	7: 34,245,671	S595P	probably benign	Het
A2m	C	A	6: 121,641,332	Q195K	probably damaging	Het
Abcg4	C	T	9: 44,279,600	G249R	probably damaging	Het
Actn1	T	C	12: 80,183,602	T293A	probably benign	Het
Adamts5	T	A	16: 85,877,981	T432S	probably benign	Het
Adh5	A	G	3: 138,454,745	T347A	probably benign	Het
Agbl5	A	G	5: 30,893,391	D432G	probably damaging	Het
Ank3	A	G	10: 69,899,051	T797A	possibly damaging	Het
Aoc1	T	G	6: 48,908,790	V743G	probably benign	Het
Arap2	A	T	5: 62,676,549	S858R	probably benign	Het
Arid1a	A	C	4: 133,753,127	V162G	possibly damaging	Het
Armc9	A	G	1: 86,213,092	D588G	possibly damaging	Het
Art3	A	G	5: 92,392,680	Y94C	probably damaging	Het
Btaf1	T	A	19: 36,969,127	D444E	probably damaging	Het
Cav2	A	G	6: 17,282,076	H111R	probably damaging	Het
Ccdc148	A	G	2: 58,827,584	L469P	probably damaging	Het
Celsr2	T	A	3: 108,413,090	E802V	possibly damaging	Het
Cfap57	T	C	4: 118,595,784	D574G	probably damaging	Het
Chd7	A	C	4: 8,854,731	D2024A	probably benign	Het
Corin	T	A	5: 72,435,247	D269V	possibly damaging	Het
Cyp4a12a	A	T	4: 115,327,598	I359F	probably damaging	Het
Defb6	T	C	8: 19,225,524	L7P	probably damaging	Het
Dnah7c	A	T	1: 46,647,036	M1817L	possibly damaging	Het
Dock3	A	G	9: 106,989,465	F682S	probably damaging	Het
Enpep	T	A	3: 129,271,403	Y879F	possibly damaging	Het
Enpp2	T	C	15: 54,866,736	N462S	probably damaging	Het
Ephb3	T	C	16: 21,217,357		probably null	Het
F7	C	T	8: 13,035,215	H414Y	probably benign	Het
Fbn1	T	C	2: 125,505,455	H50R	possibly damaging	Het
Fig4	T	C	10: 41,240,637	D586G	possibly damaging	Het
Fryl	A	G	5: 73,023,988	L2825P	probably damaging	Het
Gal3st2	T	A	1: 93,872,518	H30Q	possibly damaging	Het
Gm12886	G	A	4: 121,417,474	Q70*	probably null	Het
Gm8104	A	C	14: 43,110,044	T190P	probably benign	Het
Hps3	A	T	3: 20,011,428	N749K	probably damaging	Het
Hr	A	G	14: 70,571,486	T1101A	probably damaging	Het
Htatip2	T	A	7: 49,773,326	S210T	probably benign	Het
Ift80	T	C	3: 68,994,282		probably null	Het
Iqgap1	A	G	7: 80,760,829	V212A	possibly damaging	Het
Itih5	A	G	2: 10,238,796	E448G	probably damaging	Het
Kdm5b	T	C	1: 134,624,948	C1221R	probably damaging	Het
Lrrc72	T	C	12: 36,212,693	Y52C	probably benign	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
Mdn1	T	C	4: 32,739,030	I3617T	possibly damaging	Het
Mtpap	T	A	18: 4,379,705	H98Q	possibly damaging	Het
Nemf	A	T	12: 69,337,959		probably null	Het
Neto1	A	T	18: 86,498,931	I458L	probably benign	Het
Nfam1	T	A	15: 83,014,962	M128L	probably benign	Het
Olfr1279	A	G	2: 111,306,921	T239A	probably damaging	Het
Olfr1383	C	A	11: 49,524,381	H219Q	probably benign	Het
Olfr501-ps1	C	T	7: 108,508,593	T179I	unknown	Het
Olfr914	A	T	9: 38,607,088	I208F	probably benign	Het
P2ry14	C	T	3: 59,116,045	G7D	probably benign	Het
Pde11a	A	G	2: 76,136,414	Y564H	probably damaging	Het
Pex5l	C	T	3: 33,004,318	V262I	probably benign	Het
Poli	A	G	18: 70,508,978	V717A	possibly damaging	Het
Prdm14	A	T	1: 13,125,559	W93R	probably damaging	Het
Rbm46	T	C	3: 82,864,121	M396V	probably benign	Het
Rcor2	T	C	19: 7,271,222	V212A	probably benign	Het
Rcor3	C	A	1: 192,137,876	G8V	probably damaging	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Skp2	T	A	15: 9,113,832	Q366L	probably damaging	Het
Slc13a3	A	T	2: 165,427,114	S312T	probably benign	Het
Sstr1	T	C	12: 58,213,356	L255P	probably damaging	Het
Steap3	T	C	1: 120,227,855	E458G	possibly damaging	Het
Sv2b	T	A	7: 75,147,713	D311V	probably damaging	Het
Tmem132b	A	G	5: 125,638,268	D347G	probably benign	Het
Tmem161a	A	G	8: 70,177,488	D108G	probably damaging	Het
Trp53bp2	C	T	1: 182,446,568	Q95*	probably null	Het
Ttn	G	T	2: 76,877,143		probably null	Het
Usf3	T	C	16: 44,220,034	S1626P	probably benign	Het
Usp3	T	C	9: 66,566,898	R33G	probably benign	Het
Zbtb20	G	T	16: 43,610,676	A517S	probably damaging	Het

Other mutations in Traf5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00499:Traf5	APN	1	192057174	missense	possibly damaging	0.95
IGL01462:Traf5	APN	1	191999867	missense	probably benign
IGL02262:Traf5	APN	1	191997675	missense	probably damaging	1.00
IGL02579:Traf5	APN	1	191999887	missense	probably damaging	0.99
IGL03308:Traf5	APN	1	191997500	missense	probably damaging	0.99
PIT4445001:Traf5	UTSW	1	191997807	missense
R0028:Traf5	UTSW	1	192074121	intron	probably benign
R0689:Traf5	UTSW	1	191997876	missense	probably benign	0.16
R1511:Traf5	UTSW	1	191999951	missense	probably benign	0.01
R1641:Traf5	UTSW	1	191997509	missense	probably benign	0.20
R2235:Traf5	UTSW	1	192054391	missense	probably damaging	1.00
R2246:Traf5	UTSW	1	192066890	splice site	probably null
R2301:Traf5	UTSW	1	191997965	missense	probably benign	0.01
R3973:Traf5	UTSW	1	191997876	missense	probably benign	0.16
R4396:Traf5	UTSW	1	191997845	missense	probably benign	0.22
R4793:Traf5	UTSW	1	191997804	missense	probably benign	0.38
R4834:Traf5	UTSW	1	192066898	missense	probably benign	0.10
R5779:Traf5	UTSW	1	191997672	missense	probably damaging	1.00
R5795:Traf5	UTSW	1	191999846	missense	probably benign	0.00
R5843:Traf5	UTSW	1	191997485	missense	possibly damaging	0.55
R5912:Traf5	UTSW	1	191998069	intron	probably benign
R5963:Traf5	UTSW	1	192000016	missense	probably benign	0.06
R6246:Traf5	UTSW	1	192070553	missense	probably damaging	0.99
R6287:Traf5	UTSW	1	191999872	missense	probably damaging	1.00
R6455:Traf5	UTSW	1	191999926	missense	probably benign	0.00
R7248:Traf5	UTSW	1	192059017	missense	probably benign	0.20
R8147:Traf5	UTSW	1	192062684	missense	probably damaging	1.00
R9301:Traf5	UTSW	1	191997528	missense
R9307:Traf5	UTSW	1	192062733	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTAGAATCTCATGCTGCTTC -3'
(R):5'- CGCTACAAATCCGATGTCTCG -3'

Sequencing Primer
(F):5'- TGCTGCTTCACAAACAGGATTCAG -3'
(R):5'- AAATCCGATGTCTCGTTTCCAAGAC -3'

Posted On

2019-10-07