Incidental Mutation 'R7452:Traf5'
ID 577774
Institutional Source Beutler Lab
Gene Symbol Traf5
Ensembl Gene ENSMUSG00000026637
Gene Name TNF receptor-associated factor 5
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7452 (G1)
Quality Score 184.009
Status Validated
Chromosome 1
Chromosomal Location 191997205-192092559 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 191999831 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 47 (I47F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085573]
AlphaFold P70191
Predicted Effect possibly damaging
Transcript: ENSMUST00000085573
AA Change: I350F

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000082710
Gene: ENSMUSG00000026637
AA Change: I350F

DomainStartEndE-ValueType
RING 45 84 1.74e-4 SMART
Pfam:zf-TRAF 128 183 4.8e-21 PFAM
Pfam:zf-TRAF 183 241 4.2e-19 PFAM
MATH 402 525 2.42e-21 SMART
Predicted Effect
Meta Mutation Damage Score 0.0613 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The scaffold protein encoded by this gene is a member of the tumor necrosis factor receptor-associated factor (TRAF) protein family and contains a meprin and TRAF homology (MATH) domain, a RING-type zinc finger, and two TRAF-type zinc fingers. TRAF proteins are associated with, and mediate signal transduction from members of the TNF receptor superfamily. This protein is one of the components of a multiple protein complex which binds to tumor necrosis factor (TNF) receptor cytoplasmic domains and mediates TNF-induced activation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice show defects in lymphocyte activation but are otherwise viable and develop normally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,671 S595P probably benign Het
A2m C A 6: 121,641,332 Q195K probably damaging Het
Abcg4 C T 9: 44,279,600 G249R probably damaging Het
Actn1 T C 12: 80,183,602 T293A probably benign Het
Adamts5 T A 16: 85,877,981 T432S probably benign Het
Adh5 A G 3: 138,454,745 T347A probably benign Het
Agbl5 A G 5: 30,893,391 D432G probably damaging Het
Ank3 A G 10: 69,899,051 T797A possibly damaging Het
Aoc1 T G 6: 48,908,790 V743G probably benign Het
Arap2 A T 5: 62,676,549 S858R probably benign Het
Arid1a A C 4: 133,753,127 V162G possibly damaging Het
Armc9 A G 1: 86,213,092 D588G possibly damaging Het
Art3 A G 5: 92,392,680 Y94C probably damaging Het
Btaf1 T A 19: 36,969,127 D444E probably damaging Het
Cav2 A G 6: 17,282,076 H111R probably damaging Het
Ccdc148 A G 2: 58,827,584 L469P probably damaging Het
Celsr2 T A 3: 108,413,090 E802V possibly damaging Het
Cfap57 T C 4: 118,595,784 D574G probably damaging Het
Chd7 A C 4: 8,854,731 D2024A probably benign Het
Corin T A 5: 72,435,247 D269V possibly damaging Het
Cyp4a12a A T 4: 115,327,598 I359F probably damaging Het
Defb6 T C 8: 19,225,524 L7P probably damaging Het
Dnah7c A T 1: 46,647,036 M1817L possibly damaging Het
Dock3 A G 9: 106,989,465 F682S probably damaging Het
Enpep T A 3: 129,271,403 Y879F possibly damaging Het
Enpp2 T C 15: 54,866,736 N462S probably damaging Het
Ephb3 T C 16: 21,217,357 probably null Het
F7 C T 8: 13,035,215 H414Y probably benign Het
Fbn1 T C 2: 125,505,455 H50R possibly damaging Het
Fig4 T C 10: 41,240,637 D586G possibly damaging Het
Fryl A G 5: 73,023,988 L2825P probably damaging Het
Gal3st2 T A 1: 93,872,518 H30Q possibly damaging Het
Gm12886 G A 4: 121,417,474 Q70* probably null Het
Gm8104 A C 14: 43,110,044 T190P probably benign Het
Hps3 A T 3: 20,011,428 N749K probably damaging Het
Hr A G 14: 70,571,486 T1101A probably damaging Het
Htatip2 T A 7: 49,773,326 S210T probably benign Het
Ift80 T C 3: 68,994,282 probably null Het
Iqgap1 A G 7: 80,760,829 V212A possibly damaging Het
Itih5 A G 2: 10,238,796 E448G probably damaging Het
Kdm5b T C 1: 134,624,948 C1221R probably damaging Het
Lrrc72 T C 12: 36,212,693 Y52C probably benign Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mdn1 T C 4: 32,739,030 I3617T possibly damaging Het
Mtpap T A 18: 4,379,705 H98Q possibly damaging Het
Nemf A T 12: 69,337,959 probably null Het
Neto1 A T 18: 86,498,931 I458L probably benign Het
Nfam1 T A 15: 83,014,962 M128L probably benign Het
Olfr1279 A G 2: 111,306,921 T239A probably damaging Het
Olfr1383 C A 11: 49,524,381 H219Q probably benign Het
Olfr501-ps1 C T 7: 108,508,593 T179I unknown Het
Olfr914 A T 9: 38,607,088 I208F probably benign Het
P2ry14 C T 3: 59,116,045 G7D probably benign Het
Pde11a A G 2: 76,136,414 Y564H probably damaging Het
Pex5l C T 3: 33,004,318 V262I probably benign Het
Poli A G 18: 70,508,978 V717A possibly damaging Het
Prdm14 A T 1: 13,125,559 W93R probably damaging Het
Rbm46 T C 3: 82,864,121 M396V probably benign Het
Rcor2 T C 19: 7,271,222 V212A probably benign Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Skp2 T A 15: 9,113,832 Q366L probably damaging Het
Slc13a3 A T 2: 165,427,114 S312T probably benign Het
Sstr1 T C 12: 58,213,356 L255P probably damaging Het
Steap3 T C 1: 120,227,855 E458G possibly damaging Het
Sv2b T A 7: 75,147,713 D311V probably damaging Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a A G 8: 70,177,488 D108G probably damaging Het
Trp53bp2 C T 1: 182,446,568 Q95* probably null Het
Ttn G T 2: 76,877,143 probably null Het
Usf3 T C 16: 44,220,034 S1626P probably benign Het
Usp3 T C 9: 66,566,898 R33G probably benign Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Other mutations in Traf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Traf5 APN 1 192057174 missense possibly damaging 0.95
IGL01462:Traf5 APN 1 191999867 missense probably benign
IGL02262:Traf5 APN 1 191997675 missense probably damaging 1.00
IGL02579:Traf5 APN 1 191999887 missense probably damaging 0.99
IGL03308:Traf5 APN 1 191997500 missense probably damaging 0.99
PIT4445001:Traf5 UTSW 1 191997807 missense
R0028:Traf5 UTSW 1 192074121 intron probably benign
R0689:Traf5 UTSW 1 191997876 missense probably benign 0.16
R1511:Traf5 UTSW 1 191999951 missense probably benign 0.01
R1641:Traf5 UTSW 1 191997509 missense probably benign 0.20
R2235:Traf5 UTSW 1 192054391 missense probably damaging 1.00
R2246:Traf5 UTSW 1 192066890 splice site probably null
R2301:Traf5 UTSW 1 191997965 missense probably benign 0.01
R3973:Traf5 UTSW 1 191997876 missense probably benign 0.16
R4396:Traf5 UTSW 1 191997845 missense probably benign 0.22
R4793:Traf5 UTSW 1 191997804 missense probably benign 0.38
R4834:Traf5 UTSW 1 192066898 missense probably benign 0.10
R5779:Traf5 UTSW 1 191997672 missense probably damaging 1.00
R5795:Traf5 UTSW 1 191999846 missense probably benign 0.00
R5843:Traf5 UTSW 1 191997485 missense possibly damaging 0.55
R5912:Traf5 UTSW 1 191998069 intron probably benign
R5963:Traf5 UTSW 1 192000016 missense probably benign 0.06
R6246:Traf5 UTSW 1 192070553 missense probably damaging 0.99
R6287:Traf5 UTSW 1 191999872 missense probably damaging 1.00
R6455:Traf5 UTSW 1 191999926 missense probably benign 0.00
R7248:Traf5 UTSW 1 192059017 missense probably benign 0.20
R8147:Traf5 UTSW 1 192062684 missense probably damaging 1.00
R9301:Traf5 UTSW 1 191997528 missense
R9307:Traf5 UTSW 1 192062733 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTAGAATCTCATGCTGCTTC -3'
(R):5'- CGCTACAAATCCGATGTCTCG -3'

Sequencing Primer
(F):5'- TGCTGCTTCACAAACAGGATTCAG -3'
(R):5'- AAATCCGATGTCTCGTTTCCAAGAC -3'
Posted On 2019-10-07