Incidental Mutation 'R7452:Ccdc148'
ID 577777
Institutional Source Beutler Lab
Gene Symbol Ccdc148
Ensembl Gene ENSMUSG00000036641
Gene Name coiled-coil domain containing 148
Synonyms
MMRRC Submission 045526-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R7452 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 58711082-58991027 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 58717596 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 469 (L469P)
Ref Sequence ENSEMBL: ENSMUSP00000076871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077687] [ENSMUST00000226455]
AlphaFold Q6P5U8
Predicted Effect probably damaging
Transcript: ENSMUST00000077687
AA Change: L469P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076871
Gene: ENSMUSG00000036641
AA Change: L469P

DomainStartEndE-ValueType
coiled coil region 173 195 N/A INTRINSIC
coiled coil region 289 353 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
coiled coil region 401 438 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226455
AA Change: L541P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2859 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,618,291 (GRCm39) Q195K probably damaging Het
Abcg4 C T 9: 44,190,897 (GRCm39) G249R probably damaging Het
Actn1 T C 12: 80,230,376 (GRCm39) T293A probably benign Het
Adamts5 T A 16: 85,674,869 (GRCm39) T432S probably benign Het
Adh5 A G 3: 138,160,506 (GRCm39) T347A probably benign Het
Agbl5 A G 5: 31,050,735 (GRCm39) D432G probably damaging Het
Ank3 A G 10: 69,734,881 (GRCm39) T797A possibly damaging Het
Aoc1 T G 6: 48,885,724 (GRCm39) V743G probably benign Het
Arap2 A T 5: 62,833,892 (GRCm39) S858R probably benign Het
Arid1a A C 4: 133,480,438 (GRCm39) V162G possibly damaging Het
Armc9 A G 1: 86,140,814 (GRCm39) D588G possibly damaging Het
Art3 A G 5: 92,540,539 (GRCm39) Y94C probably damaging Het
Btaf1 T A 19: 36,946,527 (GRCm39) D444E probably damaging Het
Cav2 A G 6: 17,282,075 (GRCm39) H111R probably damaging Het
Celsr2 T A 3: 108,320,406 (GRCm39) E802V possibly damaging Het
Cfap57 T C 4: 118,452,981 (GRCm39) D574G probably damaging Het
Chd7 A C 4: 8,854,731 (GRCm39) D2024A probably benign Het
Corin T A 5: 72,592,590 (GRCm39) D269V possibly damaging Het
Cyp4a12a A T 4: 115,184,795 (GRCm39) I359F probably damaging Het
Defb6 T C 8: 19,275,540 (GRCm39) L7P probably damaging Het
Dnah7c A T 1: 46,686,196 (GRCm39) M1817L possibly damaging Het
Dock3 A G 9: 106,866,664 (GRCm39) F682S probably damaging Het
Enpep T A 3: 129,065,052 (GRCm39) Y879F possibly damaging Het
Enpp2 T C 15: 54,730,132 (GRCm39) N462S probably damaging Het
Ephb3 T C 16: 21,036,107 (GRCm39) probably null Het
F7 C T 8: 13,085,215 (GRCm39) H414Y probably benign Het
Fbn1 T C 2: 125,347,375 (GRCm39) H50R possibly damaging Het
Fig4 T C 10: 41,116,633 (GRCm39) D586G possibly damaging Het
Fryl A G 5: 73,181,331 (GRCm39) L2825P probably damaging Het
Gal3st2 T A 1: 93,800,240 (GRCm39) H30Q possibly damaging Het
Garre1 A G 7: 33,945,096 (GRCm39) S595P probably benign Het
Gm12886 G A 4: 121,274,671 (GRCm39) Q70* probably null Het
Gm8104 A C 14: 42,967,501 (GRCm39) T190P probably benign Het
Hps3 A T 3: 20,065,592 (GRCm39) N749K probably damaging Het
Hr A G 14: 70,808,926 (GRCm39) T1101A probably damaging Het
Htatip2 T A 7: 49,423,074 (GRCm39) S210T probably benign Het
Ift80 T C 3: 68,901,615 (GRCm39) probably null Het
Iqgap1 A G 7: 80,410,577 (GRCm39) V212A possibly damaging Het
Itih5 A G 2: 10,243,607 (GRCm39) E448G probably damaging Het
Kdm5b T C 1: 134,552,686 (GRCm39) C1221R probably damaging Het
Lrrc72 T C 12: 36,262,692 (GRCm39) Y52C probably benign Het
Map1b C T 13: 99,644,648 (GRCm39) R85Q probably damaging Het
Mdn1 T C 4: 32,739,030 (GRCm39) I3617T possibly damaging Het
Mtpap T A 18: 4,379,705 (GRCm39) H98Q possibly damaging Het
Nemf A T 12: 69,384,733 (GRCm39) probably null Het
Neto1 A T 18: 86,517,056 (GRCm39) I458L probably benign Het
Nfam1 T A 15: 82,899,163 (GRCm39) M128L probably benign Het
Or2y13 C A 11: 49,415,208 (GRCm39) H219Q probably benign Het
Or4g16 A G 2: 111,137,266 (GRCm39) T239A probably damaging Het
Or5p75-ps1 C T 7: 108,107,800 (GRCm39) T179I unknown Het
Or8b50 A T 9: 38,518,384 (GRCm39) I208F probably benign Het
P2ry14 C T 3: 59,023,466 (GRCm39) G7D probably benign Het
Pde11a A G 2: 75,966,758 (GRCm39) Y564H probably damaging Het
Pex5l C T 3: 33,058,467 (GRCm39) V262I probably benign Het
Poli A G 18: 70,642,049 (GRCm39) V717A possibly damaging Het
Prdm14 A T 1: 13,195,783 (GRCm39) W93R probably damaging Het
Rbm46 T C 3: 82,771,428 (GRCm39) M396V probably benign Het
Rcor2 T C 19: 7,248,587 (GRCm39) V212A probably benign Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rhox4d G A X: 36,700,645 (GRCm39) G191E unknown Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Skp2 T A 15: 9,113,920 (GRCm39) Q366L probably damaging Het
Slc13a3 A T 2: 165,269,034 (GRCm39) S312T probably benign Het
Sstr1 T C 12: 58,260,142 (GRCm39) L255P probably damaging Het
Steap3 T C 1: 120,155,585 (GRCm39) E458G possibly damaging Het
Sv2b T A 7: 74,797,461 (GRCm39) D311V probably damaging Het
Tmem132b A G 5: 125,715,332 (GRCm39) D347G probably benign Het
Tmem161a A G 8: 70,630,138 (GRCm39) D108G probably damaging Het
Traf5 T A 1: 191,731,792 (GRCm39) I47F Het
Trp53bp2 C T 1: 182,274,133 (GRCm39) Q95* probably null Het
Ttn G T 2: 76,707,487 (GRCm39) probably null Het
Usf3 T C 16: 44,040,397 (GRCm39) S1626P probably benign Het
Usp3 T C 9: 66,474,180 (GRCm39) R33G probably benign Het
Zbtb20 G T 16: 43,431,039 (GRCm39) A517S probably damaging Het
Other mutations in Ccdc148
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Ccdc148 APN 2 58,719,811 (GRCm39) missense probably benign 0.00
IGL02056:Ccdc148 APN 2 58,894,081 (GRCm39) splice site probably benign
IGL02470:Ccdc148 APN 2 58,891,911 (GRCm39) missense probably damaging 0.96
PIT4585001:Ccdc148 UTSW 2 58,872,988 (GRCm39) missense probably benign 0.01
R0068:Ccdc148 UTSW 2 58,717,629 (GRCm39) missense probably benign
R0068:Ccdc148 UTSW 2 58,717,629 (GRCm39) missense probably benign
R0348:Ccdc148 UTSW 2 58,894,084 (GRCm39) splice site probably null
R1464:Ccdc148 UTSW 2 58,824,455 (GRCm39) missense probably damaging 1.00
R1464:Ccdc148 UTSW 2 58,824,455 (GRCm39) missense probably damaging 1.00
R1464:Ccdc148 UTSW 2 58,796,374 (GRCm39) nonsense probably null
R1464:Ccdc148 UTSW 2 58,796,374 (GRCm39) nonsense probably null
R1675:Ccdc148 UTSW 2 58,870,566 (GRCm39) missense probably damaging 0.96
R1677:Ccdc148 UTSW 2 58,892,176 (GRCm39) missense probably damaging 1.00
R1832:Ccdc148 UTSW 2 58,891,911 (GRCm39) missense probably damaging 0.96
R1918:Ccdc148 UTSW 2 58,872,911 (GRCm39) missense probably damaging 1.00
R2114:Ccdc148 UTSW 2 58,892,128 (GRCm39) missense probably damaging 1.00
R2115:Ccdc148 UTSW 2 58,892,128 (GRCm39) missense probably damaging 1.00
R4657:Ccdc148 UTSW 2 58,891,900 (GRCm39) missense probably benign 0.04
R4921:Ccdc148 UTSW 2 58,719,814 (GRCm39) missense probably damaging 1.00
R5022:Ccdc148 UTSW 2 58,717,644 (GRCm39) missense probably damaging 1.00
R5809:Ccdc148 UTSW 2 58,713,657 (GRCm39) missense probably damaging 1.00
R6164:Ccdc148 UTSW 2 58,713,645 (GRCm39) missense probably damaging 1.00
R6952:Ccdc148 UTSW 2 58,713,657 (GRCm39) missense probably damaging 1.00
R6987:Ccdc148 UTSW 2 58,872,926 (GRCm39) missense probably damaging 1.00
R7121:Ccdc148 UTSW 2 58,717,579 (GRCm39) missense probably damaging 1.00
R7493:Ccdc148 UTSW 2 58,899,160 (GRCm39) missense probably damaging 1.00
R7574:Ccdc148 UTSW 2 58,713,645 (GRCm39) missense probably damaging 1.00
R7666:Ccdc148 UTSW 2 58,824,512 (GRCm39) missense probably damaging 0.99
R7763:Ccdc148 UTSW 2 58,713,648 (GRCm39) missense probably benign
R8045:Ccdc148 UTSW 2 58,892,083 (GRCm39) critical splice donor site probably null
R8865:Ccdc148 UTSW 2 58,719,832 (GRCm39) missense possibly damaging 0.86
R8932:Ccdc148 UTSW 2 58,894,054 (GRCm39) missense probably benign 0.40
R9597:Ccdc148 UTSW 2 58,893,397 (GRCm39) missense probably benign 0.08
X0062:Ccdc148 UTSW 2 58,893,460 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGTGACAGATACGATTTTAAGCTG -3'
(R):5'- ACTGGCCTGGGTTTAATATTCC -3'

Sequencing Primer
(F):5'- AAGCTGTTTTGTTTTATGTCACACTC -3'
(R):5'- TCCTCTACAGCTTTAGACTTAATACG -3'
Posted On 2019-10-07