Incidental Mutation 'R7452:Hps3'
ID 577782
Institutional Source Beutler Lab
Gene Symbol Hps3
Ensembl Gene ENSMUSG00000027615
Gene Name HPS3, biogenesis of lysosomal organelles complex 2 subunit 1
Synonyms Hermansky-Pudlak syndrome 3
MMRRC Submission 045526-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R7452 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 20050109-20089478 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20065592 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 749 (N749K)
Ref Sequence ENSEMBL: ENSMUSP00000012580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003714] [ENSMUST00000012580] [ENSMUST00000108321] [ENSMUST00000108328] [ENSMUST00000108329]
AlphaFold Q91VB4
Predicted Effect probably benign
Transcript: ENSMUST00000003714
SMART Domains Protein: ENSMUSP00000003714
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000012580
AA Change: N749K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000012580
Gene: ENSMUSG00000027615
AA Change: N749K

DomainStartEndE-ValueType
Pfam:HPS3_N 3 212 2.8e-74 PFAM
Pfam:HPS3_Mid 255 640 1.3e-167 PFAM
Pfam:HPS3_C 649 1000 1.8e-175 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108321
AA Change: N617K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103957
Gene: ENSMUSG00000027615
AA Change: N617K

DomainStartEndE-ValueType
Pfam:HPS3_N 3 87 5.6e-25 PFAM
Pfam:HPS3_Mid 121 508 4.2e-161 PFAM
Pfam:HPS3_C 517 870 9.2e-199 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108328
SMART Domains Protein: ENSMUSP00000103964
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 90 203 5.1e-8 PFAM
Pfam:Cu-oxidase 220 357 9.6e-11 PFAM
Pfam:Cu-oxidase_2 280 357 1.1e-7 PFAM
Pfam:Cu-oxidase_3 444 556 1.4e-7 PFAM
Blast:FA58C 598 673 3e-6 BLAST
Pfam:Cu-oxidase_3 789 897 2.3e-9 PFAM
Pfam:Cu-oxidase_2 927 1054 8.3e-18 PFAM
low complexity region 1067 1078 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108329
SMART Domains Protein: ENSMUSP00000103965
Gene: ENSMUSG00000003617

DomainStartEndE-ValueType
Pfam:Cu-oxidase_3 89 203 8.7e-8 PFAM
Pfam:Cu-oxidase 220 357 7.8e-12 PFAM
Pfam:Cu-oxidase_2 242 356 2.1e-7 PFAM
Pfam:Cu-oxidase_3 445 555 4.4e-7 PFAM
Blast:FA58C 599 674 3e-6 BLAST
Pfam:Cu-oxidase_3 793 898 6.1e-9 PFAM
Pfam:Cu-oxidase_2 931 1055 5.2e-18 PFAM
low complexity region 1068 1079 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a potential clathrin-binding motif, consensus dileucine signals, and tyrosine-based sorting signals for targeting to vesicles of lysosomal lineage. The encoded protein may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 3. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for spontaneous null mutations exhibit hypopigmentation and prolonged bleeding associated with a platelet defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,618,291 (GRCm39) Q195K probably damaging Het
Abcg4 C T 9: 44,190,897 (GRCm39) G249R probably damaging Het
Actn1 T C 12: 80,230,376 (GRCm39) T293A probably benign Het
Adamts5 T A 16: 85,674,869 (GRCm39) T432S probably benign Het
Adh5 A G 3: 138,160,506 (GRCm39) T347A probably benign Het
Agbl5 A G 5: 31,050,735 (GRCm39) D432G probably damaging Het
Ank3 A G 10: 69,734,881 (GRCm39) T797A possibly damaging Het
Aoc1 T G 6: 48,885,724 (GRCm39) V743G probably benign Het
Arap2 A T 5: 62,833,892 (GRCm39) S858R probably benign Het
Arid1a A C 4: 133,480,438 (GRCm39) V162G possibly damaging Het
Armc9 A G 1: 86,140,814 (GRCm39) D588G possibly damaging Het
Art3 A G 5: 92,540,539 (GRCm39) Y94C probably damaging Het
Btaf1 T A 19: 36,946,527 (GRCm39) D444E probably damaging Het
Cav2 A G 6: 17,282,075 (GRCm39) H111R probably damaging Het
Ccdc148 A G 2: 58,717,596 (GRCm39) L469P probably damaging Het
Celsr2 T A 3: 108,320,406 (GRCm39) E802V possibly damaging Het
Cfap57 T C 4: 118,452,981 (GRCm39) D574G probably damaging Het
Chd7 A C 4: 8,854,731 (GRCm39) D2024A probably benign Het
Corin T A 5: 72,592,590 (GRCm39) D269V possibly damaging Het
Cyp4a12a A T 4: 115,184,795 (GRCm39) I359F probably damaging Het
Defb6 T C 8: 19,275,540 (GRCm39) L7P probably damaging Het
Dnah7c A T 1: 46,686,196 (GRCm39) M1817L possibly damaging Het
Dock3 A G 9: 106,866,664 (GRCm39) F682S probably damaging Het
Enpep T A 3: 129,065,052 (GRCm39) Y879F possibly damaging Het
Enpp2 T C 15: 54,730,132 (GRCm39) N462S probably damaging Het
Ephb3 T C 16: 21,036,107 (GRCm39) probably null Het
F7 C T 8: 13,085,215 (GRCm39) H414Y probably benign Het
Fbn1 T C 2: 125,347,375 (GRCm39) H50R possibly damaging Het
Fig4 T C 10: 41,116,633 (GRCm39) D586G possibly damaging Het
Fryl A G 5: 73,181,331 (GRCm39) L2825P probably damaging Het
Gal3st2 T A 1: 93,800,240 (GRCm39) H30Q possibly damaging Het
Garre1 A G 7: 33,945,096 (GRCm39) S595P probably benign Het
Gm12886 G A 4: 121,274,671 (GRCm39) Q70* probably null Het
Gm8104 A C 14: 42,967,501 (GRCm39) T190P probably benign Het
Hr A G 14: 70,808,926 (GRCm39) T1101A probably damaging Het
Htatip2 T A 7: 49,423,074 (GRCm39) S210T probably benign Het
Ift80 T C 3: 68,901,615 (GRCm39) probably null Het
Iqgap1 A G 7: 80,410,577 (GRCm39) V212A possibly damaging Het
Itih5 A G 2: 10,243,607 (GRCm39) E448G probably damaging Het
Kdm5b T C 1: 134,552,686 (GRCm39) C1221R probably damaging Het
Lrrc72 T C 12: 36,262,692 (GRCm39) Y52C probably benign Het
Map1b C T 13: 99,644,648 (GRCm39) R85Q probably damaging Het
Mdn1 T C 4: 32,739,030 (GRCm39) I3617T possibly damaging Het
Mtpap T A 18: 4,379,705 (GRCm39) H98Q possibly damaging Het
Nemf A T 12: 69,384,733 (GRCm39) probably null Het
Neto1 A T 18: 86,517,056 (GRCm39) I458L probably benign Het
Nfam1 T A 15: 82,899,163 (GRCm39) M128L probably benign Het
Or2y13 C A 11: 49,415,208 (GRCm39) H219Q probably benign Het
Or4g16 A G 2: 111,137,266 (GRCm39) T239A probably damaging Het
Or5p75-ps1 C T 7: 108,107,800 (GRCm39) T179I unknown Het
Or8b50 A T 9: 38,518,384 (GRCm39) I208F probably benign Het
P2ry14 C T 3: 59,023,466 (GRCm39) G7D probably benign Het
Pde11a A G 2: 75,966,758 (GRCm39) Y564H probably damaging Het
Pex5l C T 3: 33,058,467 (GRCm39) V262I probably benign Het
Poli A G 18: 70,642,049 (GRCm39) V717A possibly damaging Het
Prdm14 A T 1: 13,195,783 (GRCm39) W93R probably damaging Het
Rbm46 T C 3: 82,771,428 (GRCm39) M396V probably benign Het
Rcor2 T C 19: 7,248,587 (GRCm39) V212A probably benign Het
Rcor3 C A 1: 191,822,173 (GRCm39) G8V probably damaging Het
Rhox4d G A X: 36,700,645 (GRCm39) G191E unknown Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Skp2 T A 15: 9,113,920 (GRCm39) Q366L probably damaging Het
Slc13a3 A T 2: 165,269,034 (GRCm39) S312T probably benign Het
Sstr1 T C 12: 58,260,142 (GRCm39) L255P probably damaging Het
Steap3 T C 1: 120,155,585 (GRCm39) E458G possibly damaging Het
Sv2b T A 7: 74,797,461 (GRCm39) D311V probably damaging Het
Tmem132b A G 5: 125,715,332 (GRCm39) D347G probably benign Het
Tmem161a A G 8: 70,630,138 (GRCm39) D108G probably damaging Het
Traf5 T A 1: 191,731,792 (GRCm39) I47F Het
Trp53bp2 C T 1: 182,274,133 (GRCm39) Q95* probably null Het
Ttn G T 2: 76,707,487 (GRCm39) probably null Het
Usf3 T C 16: 44,040,397 (GRCm39) S1626P probably benign Het
Usp3 T C 9: 66,474,180 (GRCm39) R33G probably benign Het
Zbtb20 G T 16: 43,431,039 (GRCm39) A517S probably damaging Het
Other mutations in Hps3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00545:Hps3 APN 3 20,073,971 (GRCm39) missense possibly damaging 0.94
IGL00846:Hps3 APN 3 20,079,956 (GRCm39) missense probably benign 0.00
IGL01320:Hps3 APN 3 20,084,633 (GRCm39) missense probably benign 0.12
IGL01364:Hps3 APN 3 20,057,469 (GRCm39) missense possibly damaging 0.58
IGL01751:Hps3 APN 3 20,065,130 (GRCm39) missense probably damaging 1.00
IGL01843:Hps3 APN 3 20,083,165 (GRCm39) missense probably benign 0.05
IGL02294:Hps3 APN 3 20,068,212 (GRCm39) missense probably damaging 1.00
IGL02581:Hps3 APN 3 20,057,385 (GRCm39) intron probably benign
Blue UTSW 3 20,084,960 (GRCm39) missense probably damaging 1.00
earl_grey UTSW 3 20,017,173 (GRCm38) intron probably benign
gandalf UTSW 3 20,066,960 (GRCm39) nonsense probably null
pam_gray UTSW 3 20,017,173 (GRCm38) intron probably benign
R0107:Hps3 UTSW 3 20,084,960 (GRCm39) missense probably damaging 1.00
R0245:Hps3 UTSW 3 20,066,960 (GRCm39) nonsense probably null
R0421:Hps3 UTSW 3 20,083,480 (GRCm39) missense probably benign 0.00
R0524:Hps3 UTSW 3 20,066,940 (GRCm39) missense probably damaging 1.00
R0763:Hps3 UTSW 3 20,057,443 (GRCm39) missense probably damaging 1.00
R1795:Hps3 UTSW 3 20,066,859 (GRCm39) critical splice donor site probably null
R1864:Hps3 UTSW 3 20,074,123 (GRCm39) critical splice acceptor site probably null
R2029:Hps3 UTSW 3 20,084,691 (GRCm39) missense probably benign 0.01
R2101:Hps3 UTSW 3 20,066,947 (GRCm39) missense possibly damaging 0.95
R2221:Hps3 UTSW 3 20,056,527 (GRCm39) missense probably benign
R2268:Hps3 UTSW 3 20,067,099 (GRCm39) splice site probably benign
R2520:Hps3 UTSW 3 20,083,194 (GRCm39) missense probably damaging 1.00
R3809:Hps3 UTSW 3 20,072,976 (GRCm39) missense probably damaging 1.00
R3888:Hps3 UTSW 3 20,057,387 (GRCm39) critical splice donor site probably null
R3942:Hps3 UTSW 3 20,051,103 (GRCm39) missense probably damaging 1.00
R4022:Hps3 UTSW 3 20,089,425 (GRCm39) missense possibly damaging 0.69
R4156:Hps3 UTSW 3 20,083,393 (GRCm39) missense probably damaging 1.00
R4739:Hps3 UTSW 3 20,084,574 (GRCm39) critical splice acceptor site probably null
R4823:Hps3 UTSW 3 20,066,890 (GRCm39) missense probably benign 0.03
R4912:Hps3 UTSW 3 20,068,337 (GRCm39) missense probably damaging 1.00
R5307:Hps3 UTSW 3 20,066,865 (GRCm39) missense possibly damaging 0.89
R5859:Hps3 UTSW 3 20,063,034 (GRCm39) missense probably benign 0.02
R6140:Hps3 UTSW 3 20,051,151 (GRCm39) missense probably damaging 1.00
R6183:Hps3 UTSW 3 20,063,032 (GRCm39) missense probably benign 0.04
R6971:Hps3 UTSW 3 20,065,699 (GRCm39) missense probably damaging 1.00
R6981:Hps3 UTSW 3 20,076,984 (GRCm39) missense probably damaging 1.00
R7120:Hps3 UTSW 3 20,065,705 (GRCm39) missense probably damaging 1.00
R7146:Hps3 UTSW 3 20,063,050 (GRCm39) missense probably damaging 1.00
R7223:Hps3 UTSW 3 20,084,583 (GRCm39) missense probably benign 0.05
R7448:Hps3 UTSW 3 20,089,329 (GRCm39) missense probably damaging 0.99
R7560:Hps3 UTSW 3 20,084,616 (GRCm39) missense probably benign 0.29
R7659:Hps3 UTSW 3 20,076,978 (GRCm39) nonsense probably null
R7769:Hps3 UTSW 3 20,072,972 (GRCm39) splice site probably null
R8050:Hps3 UTSW 3 20,057,492 (GRCm39) missense probably benign
R8242:Hps3 UTSW 3 20,068,290 (GRCm39) missense possibly damaging 0.59
R8802:Hps3 UTSW 3 20,074,070 (GRCm39) missense probably damaging 1.00
R8822:Hps3 UTSW 3 20,057,391 (GRCm39) missense probably benign
R8945:Hps3 UTSW 3 20,068,224 (GRCm39) missense probably damaging 0.99
R9111:Hps3 UTSW 3 20,084,575 (GRCm39) critical splice acceptor site probably null
R9131:Hps3 UTSW 3 20,083,350 (GRCm39) missense probably damaging 0.98
R9645:Hps3 UTSW 3 20,084,831 (GRCm39) missense probably benign 0.01
R9728:Hps3 UTSW 3 20,065,128 (GRCm39) missense probably benign 0.06
X0021:Hps3 UTSW 3 20,084,913 (GRCm39) missense probably benign 0.14
X0066:Hps3 UTSW 3 20,070,152 (GRCm39) missense probably damaging 1.00
Z1177:Hps3 UTSW 3 20,063,065 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATGTATGGAATTTCTGCAGAAAG -3'
(R):5'- TGGCCCCTAAATCATGAAGAC -3'

Sequencing Primer
(F):5'- ACAGAAGTCTGTCTTTTCAG -3'
(R):5'- TGGCCCCTAAATCATGAAGACACTAG -3'
Posted On 2019-10-07