Mutagenetix > Incidental Mutations

Incidental Mutation 'R7452:Chd7'

577789

Institutional Source

Beutler Lab

Gene Symbol

Chd7

Ensembl Gene

ENSMUSG00000041235

Gene Name

chromodomain helicase DNA binding protein 7

Synonyms

A730019I05Rik, Cycn, Cyn, Dz, Edy, Flo, GENA 47, Gena 52, GENA 60, Lda, Mt, Obt, Todo, WBE1, Whi

MMRRC Submission

Accession Numbers

Genbank: NM_001081417; MGI: 2444748

Is this an essential gene?

Probably essential (E-score: 0.945) question?

Stock #

R7452 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8690406-8867659 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 8854731 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 2024 (D2024A)

Ref Sequence

ENSEMBL: ENSMUSP00000043903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039267] [ENSMUST00000051558] [ENSMUST00000170391]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000039267
AA Change: D2024A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000043903
Gene: ENSMUSG00000041235
AA Change: D2024A

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
low complexity region	48	59	N/A	INTRINSIC
low complexity region	107	129	N/A	INTRINSIC
low complexity region	152	178	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
low complexity region	512	535	N/A	INTRINSIC
low complexity region	585	595	N/A	INTRINSIC
low complexity region	632	696	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
low complexity region	735	748	N/A	INTRINSIC
low complexity region	759	768	N/A	INTRINSIC
CHROMO	789	854	2.54e-9	SMART
CHROMO	870	927	2.94e-5	SMART
low complexity region	928	939	N/A	INTRINSIC
DEXDc	954	1155	9.64e-38	SMART
HELICc	1310	1394	1.67e-23	SMART
Blast:DEXDc	1608	1653	8e-16	BLAST
low complexity region	1728	1739	N/A	INTRINSIC
internal_repeat_2	1774	1825	1.31e-5	PROSPERO
low complexity region	1831	1846	N/A	INTRINSIC
low complexity region	1898	1906	N/A	INTRINSIC
low complexity region	1929	1947	N/A	INTRINSIC
SANT	1952	2011	9.31e-1	SMART
internal_repeat_2	2079	2126	1.31e-5	PROSPERO
low complexity region	2173	2195	N/A	INTRINSIC
low complexity region	2218	2244	N/A	INTRINSIC
low complexity region	2387	2407	N/A	INTRINSIC
low complexity region	2437	2452	N/A	INTRINSIC
BRK	2553	2602	6.57e-23	SMART
BRK	2631	2675	3.77e-23	SMART
low complexity region	2715	2725	N/A	INTRINSIC
low complexity region	2746	2758	N/A	INTRINSIC
low complexity region	2769	2778	N/A	INTRINSIC
low complexity region	2785	2796	N/A	INTRINSIC
low complexity region	2810	2821	N/A	INTRINSIC
low complexity region	2897	2916	N/A	INTRINSIC
low complexity region	2967	2980	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000051558
AA Change: D2024A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000059079
Gene: ENSMUSG00000041235
AA Change: D2024A

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
low complexity region	48	59	N/A	INTRINSIC
low complexity region	107	129	N/A	INTRINSIC
low complexity region	152	178	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
low complexity region	512	535	N/A	INTRINSIC
low complexity region	585	595	N/A	INTRINSIC
low complexity region	632	696	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
low complexity region	735	748	N/A	INTRINSIC
low complexity region	759	768	N/A	INTRINSIC
CHROMO	789	854	2.54e-9	SMART
CHROMO	870	927	2.94e-5	SMART
low complexity region	928	939	N/A	INTRINSIC
DEXDc	954	1155	9.64e-38	SMART
HELICc	1310	1394	1.67e-23	SMART
Blast:DEXDc	1608	1653	8e-16	BLAST
low complexity region	1728	1739	N/A	INTRINSIC
internal_repeat_2	1774	1825	1.31e-5	PROSPERO
low complexity region	1831	1846	N/A	INTRINSIC
low complexity region	1898	1906	N/A	INTRINSIC
low complexity region	1929	1947	N/A	INTRINSIC
SANT	1952	2011	9.31e-1	SMART
internal_repeat_2	2079	2126	1.31e-5	PROSPERO
low complexity region	2173	2195	N/A	INTRINSIC
low complexity region	2218	2244	N/A	INTRINSIC
low complexity region	2387	2407	N/A	INTRINSIC
low complexity region	2437	2452	N/A	INTRINSIC
BRK	2553	2602	6.57e-23	SMART
BRK	2631	2675	3.77e-23	SMART
low complexity region	2715	2725	N/A	INTRINSIC
low complexity region	2746	2758	N/A	INTRINSIC
low complexity region	2769	2778	N/A	INTRINSIC
low complexity region	2785	2796	N/A	INTRINSIC
low complexity region	2810	2821	N/A	INTRINSIC
low complexity region	2897	2916	N/A	INTRINSIC
low complexity region	2967	2980	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170391

SMART Domains

Protein: ENSMUSP00000127007
Gene: ENSMUSG00000041235

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC
low complexity region	48	59	N/A	INTRINSIC
low complexity region	107	129	N/A	INTRINSIC
low complexity region	152	178	N/A	INTRINSIC
low complexity region	194	206	N/A	INTRINSIC
low complexity region	385	400	N/A	INTRINSIC
low complexity region	491	504	N/A	INTRINSIC
low complexity region	512	535	N/A	INTRINSIC
BRK	586	630	3.77e-23	SMART
low complexity region	670	680	N/A	INTRINSIC
low complexity region	701	713	N/A	INTRINSIC
low complexity region	724	733	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	765	776	N/A	INTRINSIC
low complexity region	852	871	N/A	INTRINSIC
low complexity region	922	935	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000222546

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: This gene encodes a protein containing two chromodomains and an ATP-binding helicase domain that functions as a regulator of transcription. Mutations in this gene result in an array of development defects, including inner ear problems. Mice defective for this gene exhibit many of the clinical features of the CHARGE syndrome caused by mutations in the homologous gene in human. [provided by RefSeq, Sep 2015]
PHENOTYPE: Heterozygotes for mutations of this gene exhibit a variety of combinations of hyperactivity, circling, head-bobbing, semicircular canal defects, hearing loss, reduced size, and tail-kink. [provided by MGI curators]

Allele List at MGI

All alleles(32) : Targeted, other(4) Gene trapped(19) Chemically induced(9)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	G	7: 34,245,671	S595P	probably benign	Het
A2m	C	A	6: 121,641,332	Q195K	probably damaging	Het
Abcg4	C	T	9: 44,279,600	G249R	probably damaging	Het
Actn1	T	C	12: 80,183,602	T293A	probably benign	Het
Adamts5	T	A	16: 85,877,981	T432S	probably benign	Het
Adh5	A	G	3: 138,454,745	T347A	probably benign	Het
Agbl5	A	G	5: 30,893,391	D432G	probably damaging	Het
Ank3	A	G	10: 69,899,051	T797A	possibly damaging	Het
Aoc1	T	G	6: 48,908,790	V743G	probably benign	Het
Arap2	A	T	5: 62,676,549	S858R	probably benign	Het
Arid1a	A	C	4: 133,753,127	V162G	possibly damaging	Het
Armc9	A	G	1: 86,213,092	D588G	possibly damaging	Het
Art3	A	G	5: 92,392,680	Y94C	probably damaging	Het
Btaf1	T	A	19: 36,969,127	D444E	probably damaging	Het
Cav2	A	G	6: 17,282,076	H111R	probably damaging	Het
Ccdc148	A	G	2: 58,827,584	L469P	probably damaging	Het
Celsr2	T	A	3: 108,413,090	E802V	possibly damaging	Het
Cfap57	T	C	4: 118,595,784	D574G	probably damaging	Het
Corin	T	A	5: 72,435,247	D269V	possibly damaging	Het
Cyp4a12a	A	T	4: 115,327,598	I359F	probably damaging	Het
Defb6	T	C	8: 19,225,524	L7P	probably damaging	Het
Dnah7c	A	T	1: 46,647,036	M1817L	possibly damaging	Het
Dock3	A	G	9: 106,989,465	F682S	probably damaging	Het
Enpep	T	A	3: 129,271,403	Y879F	possibly damaging	Het
Enpp2	T	C	15: 54,866,736	N462S	probably damaging	Het
Ephb3	T	C	16: 21,217,357		probably null	Het
F7	C	T	8: 13,035,215	H414Y	probably benign	Het
Fbn1	T	C	2: 125,505,455	H50R	possibly damaging	Het
Fig4	T	C	10: 41,240,637	D586G	possibly damaging	Het
Fryl	A	G	5: 73,023,988	L2825P	probably damaging	Het
Gal3st2	T	A	1: 93,872,518	H30Q	possibly damaging	Het
Gm12886	G	A	4: 121,417,474	Q70*	probably null	Het
Gm8104	A	C	14: 43,110,044	T190P	probably benign	Het
Hps3	A	T	3: 20,011,428	N749K	probably damaging	Het
Hr	A	G	14: 70,571,486	T1101A	probably damaging	Het
Htatip2	T	A	7: 49,773,326	S210T	probably benign	Het
Ift80	T	C	3: 68,994,282		probably null	Het
Iqgap1	A	G	7: 80,760,829	V212A	possibly damaging	Het
Itih5	A	G	2: 10,238,796	E448G	probably damaging	Het
Kdm5b	T	C	1: 134,624,948	C1221R	probably damaging	Het
Lrrc72	T	C	12: 36,212,693	Y52C	probably benign	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
Mdn1	T	C	4: 32,739,030	I3617T	possibly damaging	Het
Mtpap	T	A	18: 4,379,705	H98Q	possibly damaging	Het
Nemf	A	T	12: 69,337,959		probably null	Het
Neto1	A	T	18: 86,498,931	I458L	probably benign	Het
Nfam1	T	A	15: 83,014,962	M128L	probably benign	Het
Olfr1279	A	G	2: 111,306,921	T239A	probably damaging	Het
Olfr1383	C	A	11: 49,524,381	H219Q	probably benign	Het
Olfr501-ps1	C	T	7: 108,508,593	T179I	unknown	Het
Olfr914	A	T	9: 38,607,088	I208F	probably benign	Het
P2ry14	C	T	3: 59,116,045	G7D	probably benign	Het
Pde11a	A	G	2: 76,136,414	Y564H	probably damaging	Het
Pex5l	C	T	3: 33,004,318	V262I	probably benign	Het
Poli	A	G	18: 70,508,978	V717A	possibly damaging	Het
Prdm14	A	T	1: 13,125,559	W93R	probably damaging	Het
Rbm46	T	C	3: 82,864,121	M396V	probably benign	Het
Rcor2	T	C	19: 7,271,222	V212A	probably benign	Het
Rcor3	C	A	1: 192,137,876	G8V	probably damaging	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Skp2	T	A	15: 9,113,832	Q366L	probably damaging	Het
Slc13a3	A	T	2: 165,427,114	S312T	probably benign	Het
Sstr1	T	C	12: 58,213,356	L255P	probably damaging	Het
Steap3	T	C	1: 120,227,855	E458G	possibly damaging	Het
Sv2b	T	A	7: 75,147,713	D311V	probably damaging	Het
Tmem132b	A	G	5: 125,638,268	D347G	probably benign	Het
Tmem161a	A	G	8: 70,177,488	D108G	probably damaging	Het
Traf5	T	A	1: 191,999,831	I47F		Het
Trp53bp2	C	T	1: 182,446,568	Q95*	probably null	Het
Ttn	G	T	2: 76,877,143		probably null	Het
Usf3	T	C	16: 44,220,034	S1626P	probably benign	Het
Usp3	T	C	9: 66,566,898	R33G	probably benign	Het
Zbtb20	G	T	16: 43,610,676	A517S	probably damaging	Het

Other mutations in Chd7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Chd7	APN	4	8859106	missense	probably damaging	1.00
IGL00510:Chd7	APN	4	8801404	missense	probably damaging	1.00
IGL00741:Chd7	APN	4	8839454	missense	probably damaging	1.00
IGL00796:Chd7	APN	4	8847271	missense	possibly damaging	0.95
IGL00907:Chd7	APN	4	8840435	missense	probably damaging	0.98
IGL00930:Chd7	APN	4	8805181	missense	probably damaging	1.00
IGL01542:Chd7	APN	4	8859285	missense	possibly damaging	0.71
IGL01602:Chd7	APN	4	8833834	missense	probably damaging	1.00
IGL01605:Chd7	APN	4	8833834	missense	probably damaging	1.00
IGL01670:Chd7	APN	4	8827033	missense	probably damaging	0.98
IGL02434:Chd7	APN	4	8752145	missense	probably benign	0.00
IGL02531:Chd7	APN	4	8854134	missense	probably damaging	1.00
IGL02626:Chd7	APN	4	8826519	missense	probably damaging	1.00
IGL02961:Chd7	APN	4	8751542	missense	probably damaging	1.00
IGL02972:Chd7	APN	4	8855174	missense	probably benign	0.30
IGL03329:Chd7	APN	4	8841108	missense	probably damaging	1.00
Fili	UTSW	4	8839523	missense	probably damaging	1.00
D4043:Chd7	UTSW	4	8862650	missense	probably damaging	1.00
IGL02991:Chd7	UTSW	4	8828398	missense	possibly damaging	0.91
PIT4466001:Chd7	UTSW	4	8753101	missense	unknown
PIT4472001:Chd7	UTSW	4	8753101	missense	unknown
R0157:Chd7	UTSW	4	8833759	missense	probably damaging	1.00
R0179:Chd7	UTSW	4	8862516	missense	probably benign	0.22
R0240:Chd7	UTSW	4	8852670	unclassified	probably benign
R0388:Chd7	UTSW	4	8854560	missense	probably benign	0.27
R0462:Chd7	UTSW	4	8850821	missense	probably damaging	1.00
R0512:Chd7	UTSW	4	8805139	intron	probably benign
R0657:Chd7	UTSW	4	8753141	missense	probably damaging	1.00
R0799:Chd7	UTSW	4	8801310	intron	probably benign
R0885:Chd7	UTSW	4	8866432	missense	probably damaging	1.00
R1056:Chd7	UTSW	4	8822402	missense	possibly damaging	0.50
R1086:Chd7	UTSW	4	8866458	missense	probably benign	0.04
R1353:Chd7	UTSW	4	8839556	missense	probably damaging	0.99
R1466:Chd7	UTSW	4	8840561	splice site	probably null
R1466:Chd7	UTSW	4	8840561	splice site	probably null
R1605:Chd7	UTSW	4	8844675	missense	probably damaging	1.00
R1693:Chd7	UTSW	4	8864307	critical splice donor site	probably null
R1695:Chd7	UTSW	4	8833960	missense	probably damaging	1.00
R1938:Chd7	UTSW	4	8847200	missense	probably damaging	1.00
R1964:Chd7	UTSW	4	8865978	missense	probably damaging	0.96
R2020:Chd7	UTSW	4	8855226	missense	probably benign	0.00
R2134:Chd7	UTSW	4	8753147	missense	probably damaging	0.99
R2171:Chd7	UTSW	4	8752424	missense	probably damaging	1.00
R2271:Chd7	UTSW	4	8785532	missense	probably damaging	1.00
R2300:Chd7	UTSW	4	8855241	missense	probably benign	0.02
R2355:Chd7	UTSW	4	8801350	missense	possibly damaging	0.95
R3153:Chd7	UTSW	4	8855174	missense	probably benign	0.30
R3430:Chd7	UTSW	4	8844517	missense	probably damaging	0.99
R3746:Chd7	UTSW	4	8752537	missense	probably damaging	1.00
R4118:Chd7	UTSW	4	8865831	missense	probably damaging	1.00
R4119:Chd7	UTSW	4	8785658	intron	probably benign
R4332:Chd7	UTSW	4	8854143	missense	probably damaging	1.00
R4402:Chd7	UTSW	4	8866353	missense	possibly damaging	0.61
R4571:Chd7	UTSW	4	8866217	missense	probably benign	0.09
R4722:Chd7	UTSW	4	8822445	missense	probably damaging	1.00
R4821:Chd7	UTSW	4	8844706	missense	probably damaging	1.00
R4894:Chd7	UTSW	4	8838629	missense	probably damaging	0.99
R5205:Chd7	UTSW	4	8752509	missense	possibly damaging	0.60
R5344:Chd7	UTSW	4	8844417	missense	probably damaging	1.00
R5484:Chd7	UTSW	4	8828258	missense	probably damaging	1.00
R5578:Chd7	UTSW	4	8847149	missense	probably benign	0.09
R5583:Chd7	UTSW	4	8752473	missense	probably damaging	1.00
R5888:Chd7	UTSW	4	8866382	missense	probably damaging	0.98
R5905:Chd7	UTSW	4	8840553	missense	possibly damaging	0.91
R6091:Chd7	UTSW	4	8751875	missense	probably damaging	0.99
R6126:Chd7	UTSW	4	8826482	missense	probably damaging	1.00
R6399:Chd7	UTSW	4	8828274	missense	probably damaging	1.00
R6751:Chd7	UTSW	4	8833866	missense	probably damaging	1.00
R6810:Chd7	UTSW	4	8839523	missense	probably damaging	1.00
R6868:Chd7	UTSW	4	8811501	splice site	probably null
R6952:Chd7	UTSW	4	8856797	missense	probably damaging	1.00
R6986:Chd7	UTSW	4	8859285	missense	possibly damaging	0.71
R6990:Chd7	UTSW	4	8844525	missense	probably benign	0.28
R7139:Chd7	UTSW	4	8865865	missense	probably benign	0.00
R7288:Chd7	UTSW	4	8847093	missense	possibly damaging	0.92
R7355:Chd7	UTSW	4	8752196	missense	unknown
R7471:Chd7	UTSW	4	8859197	missense	probably damaging	0.96
R7588:Chd7	UTSW	4	8864039	missense	probably damaging	1.00
R7711:Chd7	UTSW	4	8805234	missense	probably benign	0.00
R7744:Chd7	UTSW	4	8862485	splice site	probably null
R7842:Chd7	UTSW	4	8854115	missense	probably benign	0.01
R7883:Chd7	UTSW	4	8826504	missense	probably damaging	1.00
R7934:Chd7	UTSW	4	8854121	missense	probably benign	0.00
R7983:Chd7	UTSW	4	8752628	missense	unknown
R7983:Chd7	UTSW	4	8844609	missense	possibly damaging	0.47
R8022:Chd7	UTSW	4	8751605	missense	unknown
R8161:Chd7	UTSW	4	8855038	missense	probably damaging	1.00
R8274:Chd7	UTSW	4	8839432	missense	probably damaging	1.00
R8278:Chd7	UTSW	4	8862485	splice site	probably null
R8358:Chd7	UTSW	4	8839529	missense	probably damaging	1.00
R8464:Chd7	UTSW	4	8811465	missense	probably benign	0.06
R8483:Chd7	UTSW	4	8822412	missense	possibly damaging	0.65
R8507:Chd7	UTSW	4	8858675	missense	probably damaging	1.00
R8535:Chd7	UTSW	4	8859211	missense	possibly damaging	0.92
R8695:Chd7	UTSW	4	8850812	missense	probably damaging	1.00
R8700:Chd7	UTSW	4	8833892	missense	probably damaging	1.00
R8755:Chd7	UTSW	4	8866069	missense	probably benign	0.31
R8774:Chd7	UTSW	4	8854692	missense	probably damaging	1.00
R8774-TAIL:Chd7	UTSW	4	8854692	missense	probably damaging	1.00
R8796:Chd7	UTSW	4	8838691	missense	probably damaging	1.00
R8992:Chd7	UTSW	4	8839589	missense	probably damaging	1.00
R9018:Chd7	UTSW	4	8847083	missense	possibly damaging	0.88
R9122:Chd7	UTSW	4	8840510	missense	possibly damaging	0.77
Z1176:Chd7	UTSW	4	8844313	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGCCAGATCTTTCCGCAG -3'
(R):5'- GTACAGTGTCCTGGATGCTC -3'

Sequencing Primer
(F):5'- AGAGAAGAAGCGGACTTTTACC -3'
(R):5'- GATGCTCGTTCCTCCGTGATG -3'

Posted On

2019-10-07