Incidental Mutation 'R7452:Agbl5'
ID577795
Institutional Source Beutler Lab
Gene Symbol Agbl5
Ensembl Gene ENSMUSG00000029165
Gene NameATP/GTP binding protein-like 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7452 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location30888694-30906965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30893391 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 432 (D432G)
Ref Sequence ENSEMBL: ENSMUSP00000063228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069705] [ENSMUST00000114700] [ENSMUST00000200695] [ENSMUST00000200850] [ENSMUST00000201168] [ENSMUST00000201225] [ENSMUST00000201817] [ENSMUST00000201917] [ENSMUST00000202060] [ENSMUST00000202109]
Predicted Effect probably damaging
Transcript: ENSMUST00000069705
AA Change: D432G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063228
Gene: ENSMUSG00000029165
AA Change: D432G

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 191 361 8.4e-19 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 4e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114700
AA Change: D461G

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110348
Gene: ENSMUSG00000029165
AA Change: D461G

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 220 390 1.1e-18 PFAM
low complexity region 413 428 N/A INTRINSIC
Blast:Zn_pept 453 518 5e-14 BLAST
low complexity region 567 577 N/A INTRINSIC
low complexity region 672 683 N/A INTRINSIC
low complexity region 743 762 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
low complexity region 824 835 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200695
SMART Domains Protein: ENSMUSP00000144109
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d2ctc__ 148 177 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200850
SMART Domains Protein: ENSMUSP00000144274
Gene: ENSMUSG00000029165

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
SCOP:d1jqga1 178 229 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201014
Predicted Effect probably damaging
Transcript: ENSMUST00000201168
AA Change: D432G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143808
Gene: ENSMUSG00000029165
AA Change: D432G

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 370 7.3e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 836 847 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201225
AA Change: D432G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143934
Gene: ENSMUSG00000029165
AA Change: D432G

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201817
AA Change: D432G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144304
Gene: ENSMUSG00000029165
AA Change: D432G

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.4e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201917
AA Change: D432G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144188
Gene: ENSMUSG00000029165
AA Change: D432G

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 372 6.5e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 737 758 N/A INTRINSIC
low complexity region 795 806 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202060
AA Change: D432G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144018
Gene: ENSMUSG00000029165
AA Change: D432G

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
Pfam:Peptidase_M14 196 373 5.9e-13 PFAM
low complexity region 384 399 N/A INTRINSIC
Blast:Zn_pept 424 489 5e-14 BLAST
low complexity region 538 548 N/A INTRINSIC
low complexity region 643 654 N/A INTRINSIC
low complexity region 714 733 N/A INTRINSIC
low complexity region 752 768 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202109
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metallocarboxypeptidase involved in protein deglutamylation and a member of the peptidase M14 family of proteins. The encoded protein has been described as a "dual-functional" deglutamylase that can remove glutamate residues from both carboxyl termini and side chains of protein substrates. This deglutamylase activity may be important in antiviral immunity. Mutations in this gene are associated with retinitis pigmentosa. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to HSV or VACV infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,671 S595P probably benign Het
A2m C A 6: 121,641,332 Q195K probably damaging Het
Abcg4 C T 9: 44,279,600 G249R probably damaging Het
Actn1 T C 12: 80,183,602 T293A probably benign Het
Adamts5 T A 16: 85,877,981 T432S probably benign Het
Adh5 A G 3: 138,454,745 T347A probably benign Het
Ank3 A G 10: 69,899,051 T797A possibly damaging Het
Aoc1 T G 6: 48,908,790 V743G probably benign Het
Arap2 A T 5: 62,676,549 S858R probably benign Het
Arid1a A C 4: 133,753,127 V162G possibly damaging Het
Armc9 A G 1: 86,213,092 D588G possibly damaging Het
Art3 A G 5: 92,392,680 Y94C probably damaging Het
Btaf1 T A 19: 36,969,127 D444E probably damaging Het
Cav2 A G 6: 17,282,076 H111R probably damaging Het
Ccdc148 A G 2: 58,827,584 L469P probably damaging Het
Celsr2 T A 3: 108,413,090 E802V possibly damaging Het
Cfap57 T C 4: 118,595,784 D574G probably damaging Het
Chd7 A C 4: 8,854,731 D2024A probably benign Het
Corin T A 5: 72,435,247 D269V possibly damaging Het
Cyp4a12a A T 4: 115,327,598 I359F probably damaging Het
Defb6 T C 8: 19,225,524 L7P probably damaging Het
Dnah7c A T 1: 46,647,036 M1817L possibly damaging Het
Dock3 A G 9: 106,989,465 F682S probably damaging Het
Enpep T A 3: 129,271,403 Y879F possibly damaging Het
Enpp2 T C 15: 54,866,736 N462S probably damaging Het
Ephb3 T C 16: 21,217,357 probably null Het
F7 C T 8: 13,035,215 H414Y probably benign Het
Fbn1 T C 2: 125,505,455 H50R possibly damaging Het
Fig4 T C 10: 41,240,637 D586G possibly damaging Het
Fryl A G 5: 73,023,988 L2825P probably damaging Het
Gal3st2 T A 1: 93,872,518 H30Q possibly damaging Het
Gm12886 G A 4: 121,417,474 Q70* probably null Het
Gm8104 A C 14: 43,110,044 T190P probably benign Het
Hps3 A T 3: 20,011,428 N749K probably damaging Het
Hr A G 14: 70,571,486 T1101A probably damaging Het
Htatip2 T A 7: 49,773,326 S210T probably benign Het
Ift80 T C 3: 68,994,282 probably null Het
Iqgap1 A G 7: 80,760,829 V212A possibly damaging Het
Itih5 A G 2: 10,238,796 E448G probably damaging Het
Kdm5b T C 1: 134,624,948 C1221R probably damaging Het
Lrrc72 T C 12: 36,212,693 Y52C probably benign Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mdn1 T C 4: 32,739,030 I3617T possibly damaging Het
Mtpap T A 18: 4,379,705 H98Q possibly damaging Het
Nemf A T 12: 69,337,959 probably null Het
Neto1 A T 18: 86,498,931 I458L probably benign Het
Nfam1 T A 15: 83,014,962 M128L probably benign Het
Olfr1279 A G 2: 111,306,921 T239A probably damaging Het
Olfr1383 C A 11: 49,524,381 H219Q probably benign Het
Olfr501-ps1 C T 7: 108,508,593 T179I unknown Het
Olfr914 A T 9: 38,607,088 I208F probably benign Het
P2ry14 C T 3: 59,116,045 G7D probably benign Het
Pde11a A G 2: 76,136,414 Y564H probably damaging Het
Pex5l C T 3: 33,004,318 V262I probably benign Het
Poli A G 18: 70,508,978 V717A possibly damaging Het
Prdm14 A T 1: 13,125,559 W93R probably damaging Het
Rbm46 T C 3: 82,864,121 M396V probably benign Het
Rcor2 T C 19: 7,271,222 V212A probably benign Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Skp2 T A 15: 9,113,832 Q366L probably damaging Het
Slc13a3 A T 2: 165,427,114 S312T probably benign Het
Sstr1 T C 12: 58,213,356 L255P probably damaging Het
Steap3 T C 1: 120,227,855 E458G possibly damaging Het
Sv2b T A 7: 75,147,713 D311V probably damaging Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a A G 8: 70,177,488 D108G probably damaging Het
Traf5 T A 1: 191,999,831 I47F Het
Trp53bp2 C T 1: 182,446,568 Q95* probably null Het
Ttn G T 2: 76,877,143 probably null Het
Usf3 T C 16: 44,220,034 S1626P probably benign Het
Usp3 T C 9: 66,566,898 R33G probably benign Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Other mutations in Agbl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01315:Agbl5 APN 5 30893234 missense probably benign 0.00
sausage UTSW 5 30894358 nonsense probably null
R0355:Agbl5 UTSW 5 30891991 critical splice donor site probably null
R0575:Agbl5 UTSW 5 30894454 missense probably damaging 1.00
R1694:Agbl5 UTSW 5 30893382 missense probably damaging 1.00
R1709:Agbl5 UTSW 5 30906241 missense probably damaging 1.00
R1829:Agbl5 UTSW 5 30903064 missense possibly damaging 0.66
R2434:Agbl5 UTSW 5 30894013 missense probably damaging 0.97
R3418:Agbl5 UTSW 5 30904723 missense probably damaging 1.00
R4827:Agbl5 UTSW 5 30895814 missense probably damaging 1.00
R4828:Agbl5 UTSW 5 30890715 missense probably damaging 1.00
R4830:Agbl5 UTSW 5 30890715 missense probably damaging 1.00
R5017:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5018:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5036:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5038:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5052:Agbl5 UTSW 5 30891214 missense possibly damaging 0.76
R5071:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5073:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5074:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5081:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5083:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5103:Agbl5 UTSW 5 30894001 missense probably damaging 1.00
R5107:Agbl5 UTSW 5 30892478 missense probably damaging 1.00
R5130:Agbl5 UTSW 5 30903059 missense probably damaging 1.00
R5395:Agbl5 UTSW 5 30890338 missense probably damaging 1.00
R5522:Agbl5 UTSW 5 30893903 unclassified probably null
R5524:Agbl5 UTSW 5 30893903 unclassified probably null
R5526:Agbl5 UTSW 5 30893903 unclassified probably null
R5657:Agbl5 UTSW 5 30894046 missense probably damaging 1.00
R5790:Agbl5 UTSW 5 30894358 nonsense probably null
R6301:Agbl5 UTSW 5 30891833 missense probably damaging 1.00
R6891:Agbl5 UTSW 5 30895178 missense probably damaging 1.00
R6919:Agbl5 UTSW 5 30904717 missense probably benign 0.13
R7388:Agbl5 UTSW 5 30903239 nonsense probably null
R7392:Agbl5 UTSW 5 30890771 critical splice donor site probably null
R7410:Agbl5 UTSW 5 30890688 missense possibly damaging 0.94
R8312:Agbl5 UTSW 5 30894506 missense probably damaging 1.00
RF007:Agbl5 UTSW 5 30903245 missense unknown
Predicted Primers PCR Primer
(F):5'- ACAATGAAGCTCACCTCGGG -3'
(R):5'- TAAGCTCTCTGGCCCTAGTG -3'

Sequencing Primer
(F):5'- TCGGGCAGTCACCTGATG -3'
(R):5'- GTGGTGTGCACAGGTCTTCC -3'
Posted On2019-10-07