Incidental Mutation 'R7452:Arap2'
ID577796
Institutional Source Beutler Lab
Gene Symbol Arap2
Ensembl Gene ENSMUSG00000037999
Gene NameArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
SynonymsCentd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7452 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location62602445-62766159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62676549 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 858 (S858R)
Ref Sequence ENSEMBL: ENSMUSP00000075924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076623]
Predicted Effect probably benign
Transcript: ENSMUST00000076623
AA Change: S858R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000075924
Gene: ENSMUSG00000037999
AA Change: S858R

DomainStartEndE-ValueType
SAM 3 70 3.69e-7 SMART
low complexity region 222 233 N/A INTRINSIC
PH 481 574 6.45e-17 SMART
PH 586 679 9.05e-12 SMART
ArfGap 684 805 9.2e-33 SMART
PH 891 1003 1.51e-8 SMART
PH 1013 1112 9.21e-4 SMART
RhoGAP 1124 1300 1.36e-50 SMART
Pfam:RA 1325 1416 2.1e-7 PFAM
PH 1429 1533 2.68e-14 SMART
coiled coil region 1561 1590 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology domains. The protein is a phosphatidylinositol (3,4,5)-trisphosphate-dependent Arf6 GAP that binds RhoA-GTP, but it lacks the predicted catalytic arginine in the RHO-GAP domain and does not have RHO-GAP activity. The protein associates with focal adhesions and functions downstream of RhoA to regulate focal adhesion dynamics. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,671 S595P probably benign Het
A2m C A 6: 121,641,332 Q195K probably damaging Het
Abcg4 C T 9: 44,279,600 G249R probably damaging Het
Actn1 T C 12: 80,183,602 T293A probably benign Het
Adamts5 T A 16: 85,877,981 T432S probably benign Het
Adh5 A G 3: 138,454,745 T347A probably benign Het
Agbl5 A G 5: 30,893,391 D432G probably damaging Het
Ank3 A G 10: 69,899,051 T797A possibly damaging Het
Aoc1 T G 6: 48,908,790 V743G probably benign Het
Arid1a A C 4: 133,753,127 V162G possibly damaging Het
Armc9 A G 1: 86,213,092 D588G possibly damaging Het
Art3 A G 5: 92,392,680 Y94C probably damaging Het
Btaf1 T A 19: 36,969,127 D444E probably damaging Het
Cav2 A G 6: 17,282,076 H111R probably damaging Het
Ccdc148 A G 2: 58,827,584 L469P probably damaging Het
Celsr2 T A 3: 108,413,090 E802V possibly damaging Het
Cfap57 T C 4: 118,595,784 D574G probably damaging Het
Chd7 A C 4: 8,854,731 D2024A probably benign Het
Corin T A 5: 72,435,247 D269V possibly damaging Het
Cyp4a12a A T 4: 115,327,598 I359F probably damaging Het
Defb6 T C 8: 19,225,524 L7P probably damaging Het
Dnah7c A T 1: 46,647,036 M1817L possibly damaging Het
Dock3 A G 9: 106,989,465 F682S probably damaging Het
Enpep T A 3: 129,271,403 Y879F possibly damaging Het
Enpp2 T C 15: 54,866,736 N462S probably damaging Het
Ephb3 T C 16: 21,217,357 probably null Het
F7 C T 8: 13,035,215 H414Y probably benign Het
Fbn1 T C 2: 125,505,455 H50R possibly damaging Het
Fig4 T C 10: 41,240,637 D586G possibly damaging Het
Fryl A G 5: 73,023,988 L2825P probably damaging Het
Gal3st2 T A 1: 93,872,518 H30Q possibly damaging Het
Gm12886 G A 4: 121,417,474 Q70* probably null Het
Gm8104 A C 14: 43,110,044 T190P probably benign Het
Hps3 A T 3: 20,011,428 N749K probably damaging Het
Hr A G 14: 70,571,486 T1101A probably damaging Het
Htatip2 T A 7: 49,773,326 S210T probably benign Het
Ift80 T C 3: 68,994,282 probably null Het
Iqgap1 A G 7: 80,760,829 V212A possibly damaging Het
Itih5 A G 2: 10,238,796 E448G probably damaging Het
Kdm5b T C 1: 134,624,948 C1221R probably damaging Het
Lrrc72 T C 12: 36,212,693 Y52C probably benign Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mdn1 T C 4: 32,739,030 I3617T possibly damaging Het
Mtpap T A 18: 4,379,705 H98Q possibly damaging Het
Nemf A T 12: 69,337,959 probably null Het
Neto1 A T 18: 86,498,931 I458L probably benign Het
Nfam1 T A 15: 83,014,962 M128L probably benign Het
Olfr1279 A G 2: 111,306,921 T239A probably damaging Het
Olfr1383 C A 11: 49,524,381 H219Q probably benign Het
Olfr501-ps1 C T 7: 108,508,593 T179I unknown Het
Olfr914 A T 9: 38,607,088 I208F probably benign Het
P2ry14 C T 3: 59,116,045 G7D probably benign Het
Pde11a A G 2: 76,136,414 Y564H probably damaging Het
Pex5l C T 3: 33,004,318 V262I probably benign Het
Poli A G 18: 70,508,978 V717A possibly damaging Het
Prdm14 A T 1: 13,125,559 W93R probably damaging Het
Rbm46 T C 3: 82,864,121 M396V probably benign Het
Rcor2 T C 19: 7,271,222 V212A probably benign Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Skp2 T A 15: 9,113,832 Q366L probably damaging Het
Slc13a3 A T 2: 165,427,114 S312T probably benign Het
Sstr1 T C 12: 58,213,356 L255P probably damaging Het
Steap3 T C 1: 120,227,855 E458G possibly damaging Het
Sv2b T A 7: 75,147,713 D311V probably damaging Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a A G 8: 70,177,488 D108G probably damaging Het
Traf5 T A 1: 191,999,831 I47F Het
Trp53bp2 C T 1: 182,446,568 Q95* probably null Het
Ttn G T 2: 76,877,143 probably null Het
Usf3 T C 16: 44,220,034 S1626P probably benign Het
Usp3 T C 9: 66,566,898 R33G probably benign Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Other mutations in Arap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Arap2 APN 5 62635962 missense probably damaging 1.00
IGL00642:Arap2 APN 5 62733058 nonsense probably null
IGL00705:Arap2 APN 5 62678023 missense probably damaging 1.00
IGL00942:Arap2 APN 5 62698389 nonsense probably null
IGL01069:Arap2 APN 5 62649856 missense probably benign
IGL01601:Arap2 APN 5 62641342 missense probably damaging 1.00
IGL01986:Arap2 APN 5 62621922 missense probably damaging 1.00
IGL02032:Arap2 APN 5 62670997 missense probably damaging 0.99
IGL02262:Arap2 APN 5 62642841 missense probably damaging 1.00
IGL02331:Arap2 APN 5 62649682 splice site probably benign
IGL02527:Arap2 APN 5 62749307 missense probably benign
IGL02803:Arap2 APN 5 62749109 missense probably benign
IGL02864:Arap2 APN 5 62677965 missense probably damaging 1.00
IGL03078:Arap2 APN 5 62733065 splice site probably benign
IGL03154:Arap2 APN 5 62642925 missense probably damaging 1.00
IGL03213:Arap2 APN 5 62749095 missense probably benign 0.00
IGL03279:Arap2 APN 5 62621910 missense probably damaging 1.00
IGL03288:Arap2 APN 5 62604616 missense probably benign 0.00
PIT4354001:Arap2 UTSW 5 62654049 missense probably damaging 1.00
R0012:Arap2 UTSW 5 62683484 missense probably damaging 1.00
R0013:Arap2 UTSW 5 62683484 missense probably damaging 1.00
R0013:Arap2 UTSW 5 62683484 missense probably damaging 1.00
R0166:Arap2 UTSW 5 62676018 missense probably damaging 1.00
R0472:Arap2 UTSW 5 62706659 missense probably damaging 1.00
R0506:Arap2 UTSW 5 62606131 missense possibly damaging 0.87
R0551:Arap2 UTSW 5 62641323 splice site probably null
R0607:Arap2 UTSW 5 62606131 missense possibly damaging 0.87
R0617:Arap2 UTSW 5 62649907 splice site probably benign
R0975:Arap2 UTSW 5 62730886 splice site probably benign
R0976:Arap2 UTSW 5 62649884 missense probably damaging 1.00
R1164:Arap2 UTSW 5 62683477 missense probably damaging 1.00
R1268:Arap2 UTSW 5 62730621 missense probably benign 0.00
R1480:Arap2 UTSW 5 62669129 nonsense probably null
R1502:Arap2 UTSW 5 62604404 missense probably benign 0.00
R1543:Arap2 UTSW 5 62606155 nonsense probably null
R1865:Arap2 UTSW 5 62698263 missense probably damaging 0.97
R1962:Arap2 UTSW 5 62676664 missense possibly damaging 0.82
R2040:Arap2 UTSW 5 62748916 missense probably damaging 0.99
R2118:Arap2 UTSW 5 62706685 missense probably damaging 1.00
R2131:Arap2 UTSW 5 62677958 missense probably damaging 1.00
R2201:Arap2 UTSW 5 62706685 missense probably damaging 1.00
R2215:Arap2 UTSW 5 62677176 missense probably damaging 1.00
R3027:Arap2 UTSW 5 62669897 missense probably damaging 1.00
R3053:Arap2 UTSW 5 62748857 missense probably benign 0.35
R3975:Arap2 UTSW 5 62748894 missense possibly damaging 0.87
R4272:Arap2 UTSW 5 62670979 missense possibly damaging 0.63
R4273:Arap2 UTSW 5 62670979 missense possibly damaging 0.63
R4326:Arap2 UTSW 5 62621863 missense possibly damaging 0.50
R4327:Arap2 UTSW 5 62621863 missense possibly damaging 0.50
R4328:Arap2 UTSW 5 62621863 missense possibly damaging 0.50
R4451:Arap2 UTSW 5 62749170 missense probably benign 0.06
R4659:Arap2 UTSW 5 62654126 missense possibly damaging 0.94
R4665:Arap2 UTSW 5 62669969 missense possibly damaging 0.95
R4715:Arap2 UTSW 5 62749094 missense probably benign 0.43
R4808:Arap2 UTSW 5 62730641 missense probably benign 0.23
R4941:Arap2 UTSW 5 62749478 missense probably benign 0.20
R4983:Arap2 UTSW 5 62676525 missense probably damaging 0.98
R5095:Arap2 UTSW 5 62654049 missense probably damaging 1.00
R5156:Arap2 UTSW 5 62669181 nonsense probably null
R5201:Arap2 UTSW 5 62683489 missense probably damaging 1.00
R5346:Arap2 UTSW 5 62714746 missense probably benign 0.39
R5359:Arap2 UTSW 5 62683419 nonsense probably null
R5426:Arap2 UTSW 5 62642816 missense probably benign 0.02
R5503:Arap2 UTSW 5 62630186 missense probably damaging 1.00
R5605:Arap2 UTSW 5 62615067 missense possibly damaging 0.47
R5764:Arap2 UTSW 5 62642854 missense probably damaging 1.00
R5813:Arap2 UTSW 5 62677163 missense probably damaging 1.00
R5846:Arap2 UTSW 5 62649773 missense probably damaging 1.00
R6084:Arap2 UTSW 5 62670954 missense possibly damaging 0.89
R6173:Arap2 UTSW 5 62749622 missense probably damaging 1.00
R6175:Arap2 UTSW 5 62714731 critical splice donor site probably null
R6249:Arap2 UTSW 5 62646193 missense probably damaging 0.99
R6386:Arap2 UTSW 5 62604522 missense possibly damaging 0.89
R6424:Arap2 UTSW 5 62683364 missense probably damaging 1.00
R6744:Arap2 UTSW 5 62748938 missense probably damaging 1.00
R6766:Arap2 UTSW 5 62677100 critical splice donor site probably null
R6990:Arap2 UTSW 5 62676517 missense probably damaging 0.96
R7067:Arap2 UTSW 5 62654044 critical splice donor site probably null
R7098:Arap2 UTSW 5 62675950 critical splice donor site probably null
R7107:Arap2 UTSW 5 62606208 missense probably damaging 0.98
R7156:Arap2 UTSW 5 62604571 missense probably damaging 1.00
R7174:Arap2 UTSW 5 62604278 missense probably benign
R7187:Arap2 UTSW 5 62669053 missense probably damaging 0.99
R7197:Arap2 UTSW 5 62641386 missense possibly damaging 0.89
R7214:Arap2 UTSW 5 62749338 missense probably benign 0.00
R7317:Arap2 UTSW 5 62649724 missense probably damaging 1.00
R7392:Arap2 UTSW 5 62698385 missense possibly damaging 0.54
R7438:Arap2 UTSW 5 62749475 missense probably damaging 0.99
R7495:Arap2 UTSW 5 62676550 missense possibly damaging 0.78
R7796:Arap2 UTSW 5 62730762 missense probably damaging 1.00
R7936:Arap2 UTSW 5 62730705 missense probably damaging 0.96
R8116:Arap2 UTSW 5 62730611 missense probably benign 0.00
R8172:Arap2 UTSW 5 62621981 splice site probably null
R8277:Arap2 UTSW 5 62613992 critical splice donor site probably null
R8369:Arap2 UTSW 5 62604326 nonsense probably null
R8398:Arap2 UTSW 5 62748909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGCAAAGAAGCACACACTTAAGC -3'
(R):5'- AGCTGGACTCACATTCACTTCC -3'

Sequencing Primer
(F):5'- GAAGCACACACTTAAGCCATAG -3'
(R):5'- CCACCAATGTCCTTTGAATGCATAGG -3'
Posted On2019-10-07