Mutagenetix > Incidental Mutations

Incidental Mutation 'R7452:Arap2'

577796

Institutional Source

Beutler Lab

Gene Symbol

Arap2

Ensembl Gene

ENSMUSG00000037999

Gene Name

ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2

Synonyms

Centd1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7452 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62602445-62766159 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 62676549 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 858 (S858R)

Ref Sequence

ENSEMBL: ENSMUSP00000075924 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076623]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000076623
AA Change: S858R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000075924
Gene: ENSMUSG00000037999
AA Change: S858R

Domain	Start	End	E-Value	Type
SAM	3	70	3.69e-7	SMART
low complexity region	222	233	N/A	INTRINSIC
PH	481	574	6.45e-17	SMART
PH	586	679	9.05e-12	SMART
ArfGap	684	805	9.2e-33	SMART
PH	891	1003	1.51e-8	SMART
PH	1013	1112	9.21e-4	SMART
RhoGAP	1124	1300	1.36e-50	SMART
Pfam:RA	1325	1416	2.1e-7	PFAM
PH	1429	1533	2.68e-14	SMART
coiled coil region	1561	1590	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology domains. The protein is a phosphatidylinositol (3,4,5)-trisphosphate-dependent Arf6 GAP that binds RhoA-GTP, but it lacks the predicted catalytic arginine in the RHO-GAP domain and does not have RHO-GAP activity. The protein associates with focal adhesions and functions downstream of RhoA to regulate focal adhesion dynamics. [provided by RefSeq, Sep 2008]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	G	7: 34,245,671	S595P	probably benign	Het
A2m	C	A	6: 121,641,332	Q195K	probably damaging	Het
Abcg4	C	T	9: 44,279,600	G249R	probably damaging	Het
Actn1	T	C	12: 80,183,602	T293A	probably benign	Het
Adamts5	T	A	16: 85,877,981	T432S	probably benign	Het
Adh5	A	G	3: 138,454,745	T347A	probably benign	Het
Agbl5	A	G	5: 30,893,391	D432G	probably damaging	Het
Ank3	A	G	10: 69,899,051	T797A	possibly damaging	Het
Aoc1	T	G	6: 48,908,790	V743G	probably benign	Het
Arid1a	A	C	4: 133,753,127	V162G	possibly damaging	Het
Armc9	A	G	1: 86,213,092	D588G	possibly damaging	Het
Art3	A	G	5: 92,392,680	Y94C	probably damaging	Het
Btaf1	T	A	19: 36,969,127	D444E	probably damaging	Het
Cav2	A	G	6: 17,282,076	H111R	probably damaging	Het
Ccdc148	A	G	2: 58,827,584	L469P	probably damaging	Het
Celsr2	T	A	3: 108,413,090	E802V	possibly damaging	Het
Cfap57	T	C	4: 118,595,784	D574G	probably damaging	Het
Chd7	A	C	4: 8,854,731	D2024A	probably benign	Het
Corin	T	A	5: 72,435,247	D269V	possibly damaging	Het
Cyp4a12a	A	T	4: 115,327,598	I359F	probably damaging	Het
Defb6	T	C	8: 19,225,524	L7P	probably damaging	Het
Dnah7c	A	T	1: 46,647,036	M1817L	possibly damaging	Het
Dock3	A	G	9: 106,989,465	F682S	probably damaging	Het
Enpep	T	A	3: 129,271,403	Y879F	possibly damaging	Het
Enpp2	T	C	15: 54,866,736	N462S	probably damaging	Het
Ephb3	T	C	16: 21,217,357		probably null	Het
F7	C	T	8: 13,035,215	H414Y	probably benign	Het
Fbn1	T	C	2: 125,505,455	H50R	possibly damaging	Het
Fig4	T	C	10: 41,240,637	D586G	possibly damaging	Het
Fryl	A	G	5: 73,023,988	L2825P	probably damaging	Het
Gal3st2	T	A	1: 93,872,518	H30Q	possibly damaging	Het
Gm12886	G	A	4: 121,417,474	Q70*	probably null	Het
Gm8104	A	C	14: 43,110,044	T190P	probably benign	Het
Hps3	A	T	3: 20,011,428	N749K	probably damaging	Het
Hr	A	G	14: 70,571,486	T1101A	probably damaging	Het
Htatip2	T	A	7: 49,773,326	S210T	probably benign	Het
Ift80	T	C	3: 68,994,282		probably null	Het
Iqgap1	A	G	7: 80,760,829	V212A	possibly damaging	Het
Itih5	A	G	2: 10,238,796	E448G	probably damaging	Het
Kdm5b	T	C	1: 134,624,948	C1221R	probably damaging	Het
Lrrc72	T	C	12: 36,212,693	Y52C	probably benign	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
Mdn1	T	C	4: 32,739,030	I3617T	possibly damaging	Het
Mtpap	T	A	18: 4,379,705	H98Q	possibly damaging	Het
Nemf	A	T	12: 69,337,959		probably null	Het
Neto1	A	T	18: 86,498,931	I458L	probably benign	Het
Nfam1	T	A	15: 83,014,962	M128L	probably benign	Het
Olfr1279	A	G	2: 111,306,921	T239A	probably damaging	Het
Olfr1383	C	A	11: 49,524,381	H219Q	probably benign	Het
Olfr501-ps1	C	T	7: 108,508,593	T179I	unknown	Het
Olfr914	A	T	9: 38,607,088	I208F	probably benign	Het
P2ry14	C	T	3: 59,116,045	G7D	probably benign	Het
Pde11a	A	G	2: 76,136,414	Y564H	probably damaging	Het
Pex5l	C	T	3: 33,004,318	V262I	probably benign	Het
Poli	A	G	18: 70,508,978	V717A	possibly damaging	Het
Prdm14	A	T	1: 13,125,559	W93R	probably damaging	Het
Rbm46	T	C	3: 82,864,121	M396V	probably benign	Het
Rcor2	T	C	19: 7,271,222	V212A	probably benign	Het
Rcor3	C	A	1: 192,137,876	G8V	probably damaging	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Skp2	T	A	15: 9,113,832	Q366L	probably damaging	Het
Slc13a3	A	T	2: 165,427,114	S312T	probably benign	Het
Sstr1	T	C	12: 58,213,356	L255P	probably damaging	Het
Steap3	T	C	1: 120,227,855	E458G	possibly damaging	Het
Sv2b	T	A	7: 75,147,713	D311V	probably damaging	Het
Tmem132b	A	G	5: 125,638,268	D347G	probably benign	Het
Tmem161a	A	G	8: 70,177,488	D108G	probably damaging	Het
Traf5	T	A	1: 191,999,831	I47F		Het
Trp53bp2	C	T	1: 182,446,568	Q95*	probably null	Het
Ttn	G	T	2: 76,877,143		probably null	Het
Usf3	T	C	16: 44,220,034	S1626P	probably benign	Het
Usp3	T	C	9: 66,566,898	R33G	probably benign	Het
Zbtb20	G	T	16: 43,610,676	A517S	probably damaging	Het

Other mutations in Arap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Arap2	APN	5	62635962	missense	probably damaging	1.00
IGL00642:Arap2	APN	5	62733058	nonsense	probably null
IGL00705:Arap2	APN	5	62678023	missense	probably damaging	1.00
IGL00942:Arap2	APN	5	62698389	nonsense	probably null
IGL01069:Arap2	APN	5	62649856	missense	probably benign
IGL01601:Arap2	APN	5	62641342	missense	probably damaging	1.00
IGL01986:Arap2	APN	5	62621922	missense	probably damaging	1.00
IGL02032:Arap2	APN	5	62670997	missense	probably damaging	0.99
IGL02262:Arap2	APN	5	62642841	missense	probably damaging	1.00
IGL02331:Arap2	APN	5	62649682	splice site	probably benign
IGL02527:Arap2	APN	5	62749307	missense	probably benign
IGL02803:Arap2	APN	5	62749109	missense	probably benign
IGL02864:Arap2	APN	5	62677965	missense	probably damaging	1.00
IGL03078:Arap2	APN	5	62733065	splice site	probably benign
IGL03154:Arap2	APN	5	62642925	missense	probably damaging	1.00
IGL03213:Arap2	APN	5	62749095	missense	probably benign	0.00
IGL03279:Arap2	APN	5	62621910	missense	probably damaging	1.00
IGL03288:Arap2	APN	5	62604616	missense	probably benign	0.00
PIT4354001:Arap2	UTSW	5	62654049	missense	probably damaging	1.00
R0012:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0013:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0013:Arap2	UTSW	5	62683484	missense	probably damaging	1.00
R0166:Arap2	UTSW	5	62676018	missense	probably damaging	1.00
R0472:Arap2	UTSW	5	62706659	missense	probably damaging	1.00
R0506:Arap2	UTSW	5	62606131	missense	possibly damaging	0.87
R0551:Arap2	UTSW	5	62641323	splice site	probably null
R0607:Arap2	UTSW	5	62606131	missense	possibly damaging	0.87
R0617:Arap2	UTSW	5	62649907	splice site	probably benign
R0975:Arap2	UTSW	5	62730886	splice site	probably benign
R0976:Arap2	UTSW	5	62649884	missense	probably damaging	1.00
R1164:Arap2	UTSW	5	62683477	missense	probably damaging	1.00
R1268:Arap2	UTSW	5	62730621	missense	probably benign	0.00
R1480:Arap2	UTSW	5	62669129	nonsense	probably null
R1502:Arap2	UTSW	5	62604404	missense	probably benign	0.00
R1543:Arap2	UTSW	5	62606155	nonsense	probably null
R1865:Arap2	UTSW	5	62698263	missense	probably damaging	0.97
R1962:Arap2	UTSW	5	62676664	missense	possibly damaging	0.82
R2040:Arap2	UTSW	5	62748916	missense	probably damaging	0.99
R2118:Arap2	UTSW	5	62706685	missense	probably damaging	1.00
R2131:Arap2	UTSW	5	62677958	missense	probably damaging	1.00
R2201:Arap2	UTSW	5	62706685	missense	probably damaging	1.00
R2215:Arap2	UTSW	5	62677176	missense	probably damaging	1.00
R3027:Arap2	UTSW	5	62669897	missense	probably damaging	1.00
R3053:Arap2	UTSW	5	62748857	missense	probably benign	0.35
R3975:Arap2	UTSW	5	62748894	missense	possibly damaging	0.87
R4272:Arap2	UTSW	5	62670979	missense	possibly damaging	0.63
R4273:Arap2	UTSW	5	62670979	missense	possibly damaging	0.63
R4326:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4327:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4328:Arap2	UTSW	5	62621863	missense	possibly damaging	0.50
R4451:Arap2	UTSW	5	62749170	missense	probably benign	0.06
R4659:Arap2	UTSW	5	62654126	missense	possibly damaging	0.94
R4665:Arap2	UTSW	5	62669969	missense	possibly damaging	0.95
R4715:Arap2	UTSW	5	62749094	missense	probably benign	0.43
R4808:Arap2	UTSW	5	62730641	missense	probably benign	0.23
R4941:Arap2	UTSW	5	62749478	missense	probably benign	0.20
R4983:Arap2	UTSW	5	62676525	missense	probably damaging	0.98
R5095:Arap2	UTSW	5	62654049	missense	probably damaging	1.00
R5156:Arap2	UTSW	5	62669181	nonsense	probably null
R5201:Arap2	UTSW	5	62683489	missense	probably damaging	1.00
R5346:Arap2	UTSW	5	62714746	missense	probably benign	0.39
R5359:Arap2	UTSW	5	62683419	nonsense	probably null
R5426:Arap2	UTSW	5	62642816	missense	probably benign	0.02
R5503:Arap2	UTSW	5	62630186	missense	probably damaging	1.00
R5605:Arap2	UTSW	5	62615067	missense	possibly damaging	0.47
R5764:Arap2	UTSW	5	62642854	missense	probably damaging	1.00
R5813:Arap2	UTSW	5	62677163	missense	probably damaging	1.00
R5846:Arap2	UTSW	5	62649773	missense	probably damaging	1.00
R6084:Arap2	UTSW	5	62670954	missense	possibly damaging	0.89
R6173:Arap2	UTSW	5	62749622	missense	probably damaging	1.00
R6175:Arap2	UTSW	5	62714731	critical splice donor site	probably null
R6249:Arap2	UTSW	5	62646193	missense	probably damaging	0.99
R6386:Arap2	UTSW	5	62604522	missense	possibly damaging	0.89
R6424:Arap2	UTSW	5	62683364	missense	probably damaging	1.00
R6744:Arap2	UTSW	5	62748938	missense	probably damaging	1.00
R6766:Arap2	UTSW	5	62677100	critical splice donor site	probably null
R6990:Arap2	UTSW	5	62676517	missense	probably damaging	0.96
R7067:Arap2	UTSW	5	62654044	critical splice donor site	probably null
R7098:Arap2	UTSW	5	62675950	critical splice donor site	probably null
R7107:Arap2	UTSW	5	62606208	missense	probably damaging	0.98
R7156:Arap2	UTSW	5	62604571	missense	probably damaging	1.00
R7174:Arap2	UTSW	5	62604278	missense	probably benign
R7187:Arap2	UTSW	5	62669053	missense	probably damaging	0.99
R7197:Arap2	UTSW	5	62641386	missense	possibly damaging	0.89
R7214:Arap2	UTSW	5	62749338	missense	probably benign	0.00
R7317:Arap2	UTSW	5	62649724	missense	probably damaging	1.00
R7392:Arap2	UTSW	5	62698385	missense	possibly damaging	0.54
R7438:Arap2	UTSW	5	62749475	missense	probably damaging	0.99
R7495:Arap2	UTSW	5	62676550	missense	possibly damaging	0.78
R7796:Arap2	UTSW	5	62730762	missense	probably damaging	1.00
R7936:Arap2	UTSW	5	62730705	missense	probably damaging	0.96
R8116:Arap2	UTSW	5	62730611	missense	probably benign	0.00
R8172:Arap2	UTSW	5	62621981	splice site	probably null
R8277:Arap2	UTSW	5	62613992	critical splice donor site	probably null
R8369:Arap2	UTSW	5	62604326	nonsense	probably null
R8398:Arap2	UTSW	5	62748909	missense	probably damaging	1.00
R8893:Arap2	UTSW	5	62730694	missense	probably damaging	1.00
R8973:Arap2	UTSW	5	62698325	nonsense	probably null
R9102:Arap2	UTSW	5	62748998	missense	probably benign	0.03
R9121:Arap2	UTSW	5	62748983	missense	possibly damaging	0.84
R9174:Arap2	UTSW	5	62698263	missense	probably damaging	1.00
R9222:Arap2	UTSW	5	62671078	missense	possibly damaging	0.96
R9281:Arap2	UTSW	5	62749505	missense	probably damaging	0.97
R9399:Arap2	UTSW	5	62606112	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- TTTGCAAAGAAGCACACACTTAAGC -3'
(R):5'- AGCTGGACTCACATTCACTTCC -3'

Sequencing Primer
(F):5'- GAAGCACACACTTAAGCCATAG -3'
(R):5'- CCACCAATGTCCTTTGAATGCATAGG -3'

Posted On

2019-10-07