Incidental Mutation 'R7452:Art3'
ID577799
Institutional Source Beutler Lab
Gene Symbol Art3
Ensembl Gene ENSMUSG00000034842
Gene NameADP-ribosyltransferase 3
Synonyms4930569O04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7452 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location92331827-92414628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92392680 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 94 (Y94C)
Ref Sequence ENSEMBL: ENSMUSP00000113493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113083] [ENSMUST00000117108] [ENSMUST00000118106] [ENSMUST00000119587] [ENSMUST00000120193] [ENSMUST00000120416] [ENSMUST00000120781] [ENSMUST00000121096] [ENSMUST00000124509] [ENSMUST00000125462] [ENSMUST00000128246] [ENSMUST00000138687] [ENSMUST00000145072] [ENSMUST00000154245]
Predicted Effect probably damaging
Transcript: ENSMUST00000113083
AA Change: Y94C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108706
Gene: ENSMUSG00000034842
AA Change: Y94C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 4.4e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117108
AA Change: Y94C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113041
Gene: ENSMUSG00000034842
AA Change: Y94C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 1.9e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118106
AA Change: Y94C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114083
Gene: ENSMUSG00000034842
AA Change: Y94C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 9e-66 PFAM
low complexity region 298 309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119587
AA Change: Y94C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112648
Gene: ENSMUSG00000034842
AA Change: Y94C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 4e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120193
AA Change: Y94C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113074
Gene: ENSMUSG00000034842
AA Change: Y94C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 8.4e-66 PFAM
low complexity region 298 309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120416
AA Change: Y94C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113493
Gene: ENSMUSG00000034842
AA Change: Y94C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 3.1e-65 PFAM
low complexity region 298 309 N/A INTRINSIC
low complexity region 366 373 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120781
AA Change: Y94C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113008
Gene: ENSMUSG00000034842
AA Change: Y94C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 215 1.2e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121096
AA Change: Y94C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113510
Gene: ENSMUSG00000034842
AA Change: Y94C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 251 1.8e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124509
AA Change: Y94C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119113
Gene: ENSMUSG00000034842
AA Change: Y94C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 192 8.9e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000125462
AA Change: Y94C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117995
Gene: ENSMUSG00000034842
AA Change: Y94C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 244 1.4e-63 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000116110
Gene: ENSMUSG00000034842
AA Change: Y32C

DomainStartEndE-ValueType
Pfam:ART 1 190 3e-53 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128246
AA Change: Y94C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121620
Gene: ENSMUSG00000034842
AA Change: Y94C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 206 2e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138003
Predicted Effect probably benign
Transcript: ENSMUST00000138687
SMART Domains Protein: ENSMUSP00000118746
Gene: ENSMUSG00000034842

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 65 1.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145072
AA Change: Y94C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116218
Gene: ENSMUSG00000034842
AA Change: Y94C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 108 9.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000154245
AA Change: Y94C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119283
Gene: ENSMUSG00000034842
AA Change: Y94C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:ART 29 178 4.9e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an arginine-specific ADP-ribosyltransferase. The encoded protein catalyzes a reversible reaction which modifies proteins by the addition or removal of ADP-ribose to an arginine residue to regulate the function of the modified protein. An ADP-ribosyltransferase pseudogene is located on chromosome 11. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,671 S595P probably benign Het
A2m C A 6: 121,641,332 Q195K probably damaging Het
Abcg4 C T 9: 44,279,600 G249R probably damaging Het
Actn1 T C 12: 80,183,602 T293A probably benign Het
Adamts5 T A 16: 85,877,981 T432S probably benign Het
Adh5 A G 3: 138,454,745 T347A probably benign Het
Agbl5 A G 5: 30,893,391 D432G probably damaging Het
Ank3 A G 10: 69,899,051 T797A possibly damaging Het
Aoc1 T G 6: 48,908,790 V743G probably benign Het
Arap2 A T 5: 62,676,549 S858R probably benign Het
Arid1a A C 4: 133,753,127 V162G possibly damaging Het
Armc9 A G 1: 86,213,092 D588G possibly damaging Het
Btaf1 T A 19: 36,969,127 D444E probably damaging Het
Cav2 A G 6: 17,282,076 H111R probably damaging Het
Ccdc148 A G 2: 58,827,584 L469P probably damaging Het
Celsr2 T A 3: 108,413,090 E802V possibly damaging Het
Cfap57 T C 4: 118,595,784 D574G probably damaging Het
Chd7 A C 4: 8,854,731 D2024A probably benign Het
Corin T A 5: 72,435,247 D269V possibly damaging Het
Cyp4a12a A T 4: 115,327,598 I359F probably damaging Het
Defb6 T C 8: 19,225,524 L7P probably damaging Het
Dnah7c A T 1: 46,647,036 M1817L possibly damaging Het
Dock3 A G 9: 106,989,465 F682S probably damaging Het
Enpep T A 3: 129,271,403 Y879F possibly damaging Het
Enpp2 T C 15: 54,866,736 N462S probably damaging Het
Ephb3 T C 16: 21,217,357 probably null Het
F7 C T 8: 13,035,215 H414Y probably benign Het
Fbn1 T C 2: 125,505,455 H50R possibly damaging Het
Fig4 T C 10: 41,240,637 D586G possibly damaging Het
Fryl A G 5: 73,023,988 L2825P probably damaging Het
Gal3st2 T A 1: 93,872,518 H30Q possibly damaging Het
Gm12886 G A 4: 121,417,474 Q70* probably null Het
Gm8104 A C 14: 43,110,044 T190P probably benign Het
Hps3 A T 3: 20,011,428 N749K probably damaging Het
Hr A G 14: 70,571,486 T1101A probably damaging Het
Htatip2 T A 7: 49,773,326 S210T probably benign Het
Ift80 T C 3: 68,994,282 probably null Het
Iqgap1 A G 7: 80,760,829 V212A possibly damaging Het
Itih5 A G 2: 10,238,796 E448G probably damaging Het
Kdm5b T C 1: 134,624,948 C1221R probably damaging Het
Lrrc72 T C 12: 36,212,693 Y52C probably benign Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mdn1 T C 4: 32,739,030 I3617T possibly damaging Het
Mtpap T A 18: 4,379,705 H98Q possibly damaging Het
Nemf A T 12: 69,337,959 probably null Het
Neto1 A T 18: 86,498,931 I458L probably benign Het
Nfam1 T A 15: 83,014,962 M128L probably benign Het
Olfr1279 A G 2: 111,306,921 T239A probably damaging Het
Olfr1383 C A 11: 49,524,381 H219Q probably benign Het
Olfr501-ps1 C T 7: 108,508,593 T179I unknown Het
Olfr914 A T 9: 38,607,088 I208F probably benign Het
P2ry14 C T 3: 59,116,045 G7D probably benign Het
Pde11a A G 2: 76,136,414 Y564H probably damaging Het
Pex5l C T 3: 33,004,318 V262I probably benign Het
Poli A G 18: 70,508,978 V717A possibly damaging Het
Prdm14 A T 1: 13,125,559 W93R probably damaging Het
Rbm46 T C 3: 82,864,121 M396V probably benign Het
Rcor2 T C 19: 7,271,222 V212A probably benign Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Skp2 T A 15: 9,113,832 Q366L probably damaging Het
Slc13a3 A T 2: 165,427,114 S312T probably benign Het
Sstr1 T C 12: 58,213,356 L255P probably damaging Het
Steap3 T C 1: 120,227,855 E458G possibly damaging Het
Sv2b T A 7: 75,147,713 D311V probably damaging Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a A G 8: 70,177,488 D108G probably damaging Het
Traf5 T A 1: 191,999,831 I47F Het
Trp53bp2 C T 1: 182,446,568 Q95* probably null Het
Ttn G T 2: 76,877,143 probably null Het
Usf3 T C 16: 44,220,034 S1626P probably benign Het
Usp3 T C 9: 66,566,898 R33G probably benign Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Other mutations in Art3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01526:Art3 APN 5 92414340 missense probably damaging 0.99
IGL01674:Art3 APN 5 92403614 nonsense probably null
R0011:Art3 UTSW 5 92403612 missense probably damaging 0.99
R0011:Art3 UTSW 5 92403612 missense probably damaging 0.99
R1861:Art3 UTSW 5 92412235 intron probably benign
R4131:Art3 UTSW 5 92392562 missense probably benign 0.01
R4726:Art3 UTSW 5 92411143 missense probably benign 0.10
R4810:Art3 UTSW 5 92414249 missense possibly damaging 0.84
R4959:Art3 UTSW 5 92403619 missense probably damaging 1.00
R4973:Art3 UTSW 5 92403619 missense probably damaging 1.00
R5592:Art3 UTSW 5 92392820 missense probably damaging 1.00
R5678:Art3 UTSW 5 92392550 missense probably damaging 0.99
R5813:Art3 UTSW 5 92412241 utr 3 prime probably benign
R5924:Art3 UTSW 5 92412232 intron probably benign
R6480:Art3 UTSW 5 92392817 missense probably damaging 1.00
R7549:Art3 UTSW 5 92403655 missense probably benign 0.01
R7772:Art3 UTSW 5 92403613 missense probably damaging 0.99
R7947:Art3 UTSW 5 92392500 missense possibly damaging 0.88
Z1177:Art3 UTSW 5 92412206 missense unknown
Predicted Primers PCR Primer
(F):5'- GCGTTTGACGACGAATACCTG -3'
(R):5'- AATGAAATGTCTGGGCTTGTGC -3'

Sequencing Primer
(F):5'- TTTGACGACGAATACCTGAAGTGC -3'
(R):5'- GTAACTTTTCTCGCAAGGTCG -3'
Posted On2019-10-07