Incidental Mutation 'R7452:F7'
ID577809
Institutional Source Beutler Lab
Gene Symbol F7
Ensembl Gene ENSMUSG00000031443
Gene Namecoagulation factor VII
SynonymsFVII, Cf7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R7452 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location13026034-13035809 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 13035215 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 414 (H414Y)
Ref Sequence ENSEMBL: ENSMUSP00000033820 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033820] [ENSMUST00000033821] [ENSMUST00000063820] [ENSMUST00000123768] [ENSMUST00000128418] [ENSMUST00000152034]
Predicted Effect probably benign
Transcript: ENSMUST00000033820
AA Change: H414Y

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000033820
Gene: ENSMUSG00000031443
AA Change: H414Y

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
GLA 23 86 5.41e-30 SMART
EGF_CA 87 123 2.58e-8 SMART
EGF 131 169 1.99e0 SMART
Tryp_SPc 193 428 1.14e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000033821
SMART Domains Protein: ENSMUSP00000033821
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 19 31 N/A INTRINSIC
GLA 34 97 5.98e-32 SMART
EGF_CA 98 134 4.56e-9 SMART
EGF 140 177 2.66e-1 SMART
low complexity region 201 218 N/A INTRINSIC
Tryp_SPc 243 471 9.03e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000063820
SMART Domains Protein: ENSMUSP00000068389
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Tryp_SPc 231 459 9.03e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123768
SMART Domains Protein: ENSMUSP00000116984
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF 89 119 2.25e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128418
SMART Domains Protein: ENSMUSP00000121830
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Pfam:Trypsin 232 298 4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152034
SMART Domains Protein: ENSMUSP00000117312
Gene: ENSMUSG00000031444

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
GLA 22 85 5.98e-32 SMART
EGF_CA 86 122 4.56e-9 SMART
EGF 128 165 2.66e-1 SMART
low complexity region 189 206 N/A INTRINSIC
Pfam:Trypsin 232 297 1.1e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: This gene encodes a vitamin K-dependent serine protease that plays a critical role in the extrinsic pathway of blood coagulation. Upon contact with tissue factor III (TF III), the encoded protein forms an activated complex termed TF-FVIIa that initiates the coagulation cascade involving other coagulation factors, ultimately resulting in a fibrin clot. Complete lack of the encoded protein in mice results in in perinatal lethality due to bleeding from normal blood vessels. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted null mutation developed normally through embryogenesis, and exhibited no vascular defects; however, 70% of homozygous neonates suffered fatal intra-abdominal haemorrhaging and died within 24 hours after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,671 S595P probably benign Het
A2m C A 6: 121,641,332 Q195K probably damaging Het
Abcg4 C T 9: 44,279,600 G249R probably damaging Het
Actn1 T C 12: 80,183,602 T293A probably benign Het
Adamts5 T A 16: 85,877,981 T432S probably benign Het
Adh5 A G 3: 138,454,745 T347A probably benign Het
Agbl5 A G 5: 30,893,391 D432G probably damaging Het
Ank3 A G 10: 69,899,051 T797A possibly damaging Het
Aoc1 T G 6: 48,908,790 V743G probably benign Het
Arap2 A T 5: 62,676,549 S858R probably benign Het
Arid1a A C 4: 133,753,127 V162G possibly damaging Het
Armc9 A G 1: 86,213,092 D588G possibly damaging Het
Art3 A G 5: 92,392,680 Y94C probably damaging Het
Btaf1 T A 19: 36,969,127 D444E probably damaging Het
Cav2 A G 6: 17,282,076 H111R probably damaging Het
Ccdc148 A G 2: 58,827,584 L469P probably damaging Het
Celsr2 T A 3: 108,413,090 E802V possibly damaging Het
Cfap57 T C 4: 118,595,784 D574G probably damaging Het
Chd7 A C 4: 8,854,731 D2024A probably benign Het
Corin T A 5: 72,435,247 D269V possibly damaging Het
Cyp4a12a A T 4: 115,327,598 I359F probably damaging Het
Defb6 T C 8: 19,225,524 L7P probably damaging Het
Dnah7c A T 1: 46,647,036 M1817L possibly damaging Het
Dock3 A G 9: 106,989,465 F682S probably damaging Het
Enpep T A 3: 129,271,403 Y879F possibly damaging Het
Enpp2 T C 15: 54,866,736 N462S probably damaging Het
Ephb3 T C 16: 21,217,357 probably null Het
Fbn1 T C 2: 125,505,455 H50R possibly damaging Het
Fig4 T C 10: 41,240,637 D586G possibly damaging Het
Fryl A G 5: 73,023,988 L2825P probably damaging Het
Gal3st2 T A 1: 93,872,518 H30Q possibly damaging Het
Gm12886 G A 4: 121,417,474 Q70* probably null Het
Gm8104 A C 14: 43,110,044 T190P probably benign Het
Hps3 A T 3: 20,011,428 N749K probably damaging Het
Hr A G 14: 70,571,486 T1101A probably damaging Het
Htatip2 T A 7: 49,773,326 S210T probably benign Het
Ift80 T C 3: 68,994,282 probably null Het
Iqgap1 A G 7: 80,760,829 V212A possibly damaging Het
Itih5 A G 2: 10,238,796 E448G probably damaging Het
Kdm5b T C 1: 134,624,948 C1221R probably damaging Het
Lrrc72 T C 12: 36,212,693 Y52C probably benign Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mdn1 T C 4: 32,739,030 I3617T possibly damaging Het
Mtpap T A 18: 4,379,705 H98Q possibly damaging Het
Nemf A T 12: 69,337,959 probably null Het
Neto1 A T 18: 86,498,931 I458L probably benign Het
Nfam1 T A 15: 83,014,962 M128L probably benign Het
Olfr1279 A G 2: 111,306,921 T239A probably damaging Het
Olfr1383 C A 11: 49,524,381 H219Q probably benign Het
Olfr501-ps1 C T 7: 108,508,593 T179I unknown Het
Olfr914 A T 9: 38,607,088 I208F probably benign Het
P2ry14 C T 3: 59,116,045 G7D probably benign Het
Pde11a A G 2: 76,136,414 Y564H probably damaging Het
Pex5l C T 3: 33,004,318 V262I probably benign Het
Poli A G 18: 70,508,978 V717A possibly damaging Het
Prdm14 A T 1: 13,125,559 W93R probably damaging Het
Rbm46 T C 3: 82,864,121 M396V probably benign Het
Rcor2 T C 19: 7,271,222 V212A probably benign Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Skp2 T A 15: 9,113,832 Q366L probably damaging Het
Slc13a3 A T 2: 165,427,114 S312T probably benign Het
Sstr1 T C 12: 58,213,356 L255P probably damaging Het
Steap3 T C 1: 120,227,855 E458G possibly damaging Het
Sv2b T A 7: 75,147,713 D311V probably damaging Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a A G 8: 70,177,488 D108G probably damaging Het
Traf5 T A 1: 191,999,831 I47F Het
Trp53bp2 C T 1: 182,446,568 Q95* probably null Het
Ttn G T 2: 76,877,143 probably null Het
Usf3 T C 16: 44,220,034 S1626P probably benign Het
Usp3 T C 9: 66,566,898 R33G probably benign Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Other mutations in F7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:F7 APN 8 13028802 missense probably benign 0.11
IGL01012:F7 APN 8 13033409 missense probably damaging 0.99
IGL01461:F7 APN 8 13032245 missense possibly damaging 0.94
IGL01700:F7 APN 8 13028685 missense probably benign 0.02
IGL03105:F7 APN 8 13034001 missense probably null 0.07
IGL03241:F7 APN 8 13028779 missense probably damaging 1.00
BB008:F7 UTSW 8 13035209 missense probably benign
BB018:F7 UTSW 8 13035209 missense probably benign
R0746:F7 UTSW 8 13034740 missense probably benign 0.02
R1587:F7 UTSW 8 13034783 missense possibly damaging 0.95
R1661:F7 UTSW 8 13035209 missense probably benign
R2065:F7 UTSW 8 13035183 missense probably damaging 1.00
R2905:F7 UTSW 8 13034775 missense probably benign 0.02
R4355:F7 UTSW 8 13034774 missense probably benign
R5256:F7 UTSW 8 13030763 missense probably damaging 1.00
R6115:F7 UTSW 8 13033958 missense probably benign 0.01
R6330:F7 UTSW 8 13035140 missense probably damaging 1.00
R7043:F7 UTSW 8 13033997 missense probably benign
R7505:F7 UTSW 8 13028745 missense possibly damaging 0.57
R7931:F7 UTSW 8 13035209 missense probably benign
R8273:F7 UTSW 8 13033981 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTCATGTCCATCGAGGTGC -3'
(R):5'- CAGGAAAGTCCATAGAACAGCTTC -3'

Sequencing Primer
(F):5'- TGATGACCCAGGACTGTCTG -3'
(R):5'- TAGAACAGCTTCACAGGCCGTAG -3'
Posted On2019-10-07