Incidental Mutation 'R7452:Fig4'
ID 577816
Institutional Source Beutler Lab
Gene Symbol Fig4
Ensembl Gene ENSMUSG00000038417
Gene Name FIG4 phosphoinositide 5-phosphatase
Synonyms A530089I17Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_133999.1; MGI:2143585
Essential gene? Possibly non essential (E-score: 0.399) question?
Stock # R7452 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 41188172-41303260 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 41240637 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 586 (D586G)
Ref Sequence ENSEMBL: ENSMUSP00000039598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043814]
AlphaFold Q91WF7
Predicted Effect possibly damaging
Transcript: ENSMUST00000043814
AA Change: D586G

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000039598
Gene: ENSMUSG00000038417
AA Change: D586G

DomainStartEndE-ValueType
Pfam:Syja_N 93 424 1.7e-79 PFAM
Blast:Lactamase_B 533 610 6e-21 BLAST
low complexity region 742 771 N/A INTRINSIC
low complexity region 805 813 N/A INTRINSIC
Meta Mutation Damage Score 0.6368 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype Strain: 3716838
Lethality: D30-D60
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SAC domain-containing protein gene family. The SAC domain, approximately 400 amino acids in length and consisting of seven conserved motifs, has been shown to possess phosphoinositide phosphatase activity. The yeast homolog, Sac1p, is involved in the regulation of various phosphoinositides, and affects diverse cellular functions such as actin cytoskeleton organization, Golgi function, and maintenance of vacuole morphology. Membrane-bound phosphoinositides function as signaling molecules and play a key role in vesicle trafficking in eukaryotic cells. Mutations in this gene have been associated with Charcot-Marie-Tooth disease, type 4J. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous allele exhibit premature death, severe tremors, diluted coat color, neurodegeneration, impaired coordination, muscle weakness, small size and reduced spleen. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Targeted(3) Gene trapped(12) Spontaneous(1)
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,671 S595P probably benign Het
A2m C A 6: 121,641,332 Q195K probably damaging Het
Abcg4 C T 9: 44,279,600 G249R probably damaging Het
Actn1 T C 12: 80,183,602 T293A probably benign Het
Adamts5 T A 16: 85,877,981 T432S probably benign Het
Adh5 A G 3: 138,454,745 T347A probably benign Het
Agbl5 A G 5: 30,893,391 D432G probably damaging Het
Ank3 A G 10: 69,899,051 T797A possibly damaging Het
Aoc1 T G 6: 48,908,790 V743G probably benign Het
Arap2 A T 5: 62,676,549 S858R probably benign Het
Arid1a A C 4: 133,753,127 V162G possibly damaging Het
Armc9 A G 1: 86,213,092 D588G possibly damaging Het
Art3 A G 5: 92,392,680 Y94C probably damaging Het
Btaf1 T A 19: 36,969,127 D444E probably damaging Het
Cav2 A G 6: 17,282,076 H111R probably damaging Het
Ccdc148 A G 2: 58,827,584 L469P probably damaging Het
Celsr2 T A 3: 108,413,090 E802V possibly damaging Het
Cfap57 T C 4: 118,595,784 D574G probably damaging Het
Chd7 A C 4: 8,854,731 D2024A probably benign Het
Corin T A 5: 72,435,247 D269V possibly damaging Het
Cyp4a12a A T 4: 115,327,598 I359F probably damaging Het
Defb6 T C 8: 19,225,524 L7P probably damaging Het
Dnah7c A T 1: 46,647,036 M1817L possibly damaging Het
Dock3 A G 9: 106,989,465 F682S probably damaging Het
Enpep T A 3: 129,271,403 Y879F possibly damaging Het
Enpp2 T C 15: 54,866,736 N462S probably damaging Het
Ephb3 T C 16: 21,217,357 probably null Het
F7 C T 8: 13,035,215 H414Y probably benign Het
Fbn1 T C 2: 125,505,455 H50R possibly damaging Het
Fryl A G 5: 73,023,988 L2825P probably damaging Het
Gal3st2 T A 1: 93,872,518 H30Q possibly damaging Het
Gm12886 G A 4: 121,417,474 Q70* probably null Het
Gm8104 A C 14: 43,110,044 T190P probably benign Het
Hps3 A T 3: 20,011,428 N749K probably damaging Het
Hr A G 14: 70,571,486 T1101A probably damaging Het
Htatip2 T A 7: 49,773,326 S210T probably benign Het
Ift80 T C 3: 68,994,282 probably null Het
Iqgap1 A G 7: 80,760,829 V212A possibly damaging Het
Itih5 A G 2: 10,238,796 E448G probably damaging Het
Kdm5b T C 1: 134,624,948 C1221R probably damaging Het
Lrrc72 T C 12: 36,212,693 Y52C probably benign Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mdn1 T C 4: 32,739,030 I3617T possibly damaging Het
Mtpap T A 18: 4,379,705 H98Q possibly damaging Het
Nemf A T 12: 69,337,959 probably null Het
Neto1 A T 18: 86,498,931 I458L probably benign Het
Nfam1 T A 15: 83,014,962 M128L probably benign Het
Olfr1279 A G 2: 111,306,921 T239A probably damaging Het
Olfr1383 C A 11: 49,524,381 H219Q probably benign Het
Olfr501-ps1 C T 7: 108,508,593 T179I unknown Het
Olfr914 A T 9: 38,607,088 I208F probably benign Het
P2ry14 C T 3: 59,116,045 G7D probably benign Het
Pde11a A G 2: 76,136,414 Y564H probably damaging Het
Pex5l C T 3: 33,004,318 V262I probably benign Het
Poli A G 18: 70,508,978 V717A possibly damaging Het
Prdm14 A T 1: 13,125,559 W93R probably damaging Het
Rbm46 T C 3: 82,864,121 M396V probably benign Het
Rcor2 T C 19: 7,271,222 V212A probably benign Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Skp2 T A 15: 9,113,832 Q366L probably damaging Het
Slc13a3 A T 2: 165,427,114 S312T probably benign Het
Sstr1 T C 12: 58,213,356 L255P probably damaging Het
Steap3 T C 1: 120,227,855 E458G possibly damaging Het
Sv2b T A 7: 75,147,713 D311V probably damaging Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a A G 8: 70,177,488 D108G probably damaging Het
Traf5 T A 1: 191,999,831 I47F Het
Trp53bp2 C T 1: 182,446,568 Q95* probably null Het
Ttn G T 2: 76,877,143 probably null Het
Usf3 T C 16: 44,220,034 S1626P probably benign Het
Usp3 T C 9: 66,566,898 R33G probably benign Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Other mutations in Fig4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Fig4 APN 10 41251788 missense probably damaging 0.99
IGL01013:Fig4 APN 10 41267786 missense probably benign 0.00
IGL01066:Fig4 APN 10 41285417 splice site probably benign
IGL01501:Fig4 APN 10 41270374 missense probably benign
IGL01503:Fig4 APN 10 41256518 missense probably benign 0.00
IGL01535:Fig4 APN 10 41256494 missense probably benign 0.00
IGL01733:Fig4 APN 10 41277393 missense possibly damaging 0.49
IGL01782:Fig4 APN 10 41270400 missense probably benign 0.18
IGL01866:Fig4 APN 10 41232164 missense possibly damaging 0.77
IGL01934:Fig4 APN 10 41228112 missense probably benign 0.03
IGL01966:Fig4 APN 10 41232102 splice site probably null
IGL02032:Fig4 APN 10 41303006 missense probably benign 0.00
IGL02225:Fig4 APN 10 41256452 missense probably benign
IGL02345:Fig4 APN 10 41267774 missense probably null 1.00
IGL02532:Fig4 APN 10 41285281 splice site probably benign
IGL02686:Fig4 APN 10 41264004 missense probably damaging 0.99
IGL02965:Fig4 APN 10 41285665 missense probably damaging 0.98
P0021:Fig4 UTSW 10 41251825 missense probably damaging 1.00
R0017:Fig4 UTSW 10 41273007 missense possibly damaging 0.94
R0017:Fig4 UTSW 10 41273007 missense possibly damaging 0.94
R0117:Fig4 UTSW 10 41230041 nonsense probably null
R0144:Fig4 UTSW 10 41258049 missense probably damaging 0.99
R0655:Fig4 UTSW 10 41285677 missense probably damaging 1.00
R0701:Fig4 UTSW 10 41240512 nonsense probably null
R0751:Fig4 UTSW 10 41272982 missense probably damaging 1.00
R1540:Fig4 UTSW 10 41188586 missense possibly damaging 0.60
R1586:Fig4 UTSW 10 41265427 missense probably damaging 0.99
R2916:Fig4 UTSW 10 41258075 missense probably damaging 0.98
R3927:Fig4 UTSW 10 41263139 missense probably benign
R4304:Fig4 UTSW 10 41256427 missense probably benign 0.01
R4586:Fig4 UTSW 10 41188632 missense probably damaging 1.00
R4678:Fig4 UTSW 10 41272998 missense probably benign 0.27
R4858:Fig4 UTSW 10 41233590 missense probably benign 0.00
R5614:Fig4 UTSW 10 41272985 missense probably damaging 0.98
R5896:Fig4 UTSW 10 41254885 missense possibly damaging 0.67
R6126:Fig4 UTSW 10 41265447 missense probably damaging 0.99
R7056:Fig4 UTSW 10 41220932 missense probably benign 0.09
R7350:Fig4 UTSW 10 41251756 missense probably benign 0.03
R7481:Fig4 UTSW 10 41230005 critical splice donor site probably null
R7610:Fig4 UTSW 10 41253713 missense probably damaging 1.00
R7818:Fig4 UTSW 10 41263166 missense probably damaging 0.98
R7830:Fig4 UTSW 10 41256466 missense probably benign 0.00
R8263:Fig4 UTSW 10 41267715 nonsense probably null
R8319:Fig4 UTSW 10 41263101 missense probably damaging 1.00
R8409:Fig4 UTSW 10 41265431 missense probably benign 0.01
R8435:Fig4 UTSW 10 41285674 missense probably benign
R8474:Fig4 UTSW 10 41232174 missense probably benign 0.30
R9086:Fig4 UTSW 10 41285403 missense possibly damaging 0.50
R9131:Fig4 UTSW 10 41265411 missense possibly damaging 0.95
R9248:Fig4 UTSW 10 41277482 missense probably benign
R9401:Fig4 UTSW 10 41267737 missense probably benign
R9564:Fig4 UTSW 10 41285391 missense probably benign 0.20
R9627:Fig4 UTSW 10 41232182 missense probably benign 0.01
R9649:Fig4 UTSW 10 41267767 missense probably benign 0.00
Z1088:Fig4 UTSW 10 41253731 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACAGTTATTCAATACAGCGGC -3'
(R):5'- AGAGGCAAGGCTTTCAGTCTC -3'

Sequencing Primer
(F):5'- CAGTTATTCAATACAGCGGCAACTG -3'
(R):5'- AGTCTCCTCAGATCGTGCATGG -3'
Posted On 2019-10-07