Mutagenetix > Incidental Mutation

Incidental Mutation 'R0629:Muc20'

57782

Institutional Source

Beutler Lab

Gene Symbol

Muc20

Ensembl Gene

ENSMUSG00000035638

Gene Name

mucin 20

Synonyms

MMRRC Submission

038818-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.067) question?

Stock #

R0629 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32777419-32797435 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 32793421 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 529 (T529A)

Ref Sequence

ENSEMBL: ENSMUSP00000041221 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041123] [ENSMUST00000115116]

AlphaFold

Q8BUE7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000041123
AA Change: T529A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000041221
Gene: ENSMUSG00000035638
AA Change: T529A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	97	113	N/A	INTRINSIC
internal_repeat_1	114	146	3.3e-8	PROSPERO
internal_repeat_1	138	170	3.3e-8	PROSPERO
internal_repeat_2	144	161	5.26e-5	PROSPERO
low complexity region	171	204	N/A	INTRINSIC
low complexity region	210	227	N/A	INTRINSIC
internal_repeat_2	228	245	5.26e-5	PROSPERO
low complexity region	324	351	N/A	INTRINSIC
low complexity region	376	385	N/A	INTRINSIC
low complexity region	516	550	N/A	INTRINSIC
low complexity region	574	593	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000115116
AA Change: T529A

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000110769
Gene: ENSMUSG00000035638
AA Change: T529A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	97	113	N/A	INTRINSIC
internal_repeat_1	114	146	2.16e-8	PROSPERO
internal_repeat_1	138	170	2.16e-8	PROSPERO
internal_repeat_2	144	161	4e-5	PROSPERO
low complexity region	171	204	N/A	INTRINSIC
low complexity region	210	227	N/A	INTRINSIC
internal_repeat_2	228	245	4e-5	PROSPERO
low complexity region	324	351	N/A	INTRINSIC
low complexity region	376	385	N/A	INTRINSIC
low complexity region	516	550	N/A	INTRINSIC
low complexity region	574	593	N/A	INTRINSIC
low complexity region	662	679	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins secreted by many epithelial tissues to form an insoluble mucous barrier. The C-terminus of this family member associates with the multifunctional docking site of the MET proto-oncogene and suppresses activation of some downstream MET signaling cascades. The protein features a mucin tandem repeat domain that varies between two and six copies in most individuals. Multiple variants encoding different isoforms have been found for this gene. A related pseudogene, which is also located on chromosome 3, has been identified. [provided by RefSeq, Apr 2014]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	T	17: 45,507,547	D86V	probably damaging	Het
Adamts14	G	A	10: 61,211,624	Q733*	probably null	Het
Adcy10	A	G	1: 165,543,105	D651G	probably damaging	Het
Apcdd1	T	A	18: 62,933,970	C52S	probably damaging	Het
Bclaf1	T	C	10: 20,333,426	S463P	probably damaging	Het
Cabcoco1	T	C	10: 68,516,278	Y68C	probably damaging	Het
Cacna1f	G	A	X: 7,620,434	S888N	probably damaging	Het
Cacna1g	A	G	11: 94,409,543	C2134R	possibly damaging	Het
Cdc37	A	C	9: 21,140,768	M325R	possibly damaging	Het
Clca2	T	A	3: 145,072,239	M762L	probably benign	Het
Cntn3	C	T	6: 102,203,976	V753M	probably damaging	Het
Col6a6	A	T	9: 105,727,165		probably benign	Het
Dscaml1	A	G	9: 45,721,418	D1194G	probably damaging	Het
Egfr	G	A	11: 16,869,333	G288S	probably damaging	Het
Fbxl17	G	T	17: 63,471,414	N19K	probably damaging	Het
Fmo3	A	G	1: 162,958,227		probably benign	Het
Frmd6	T	C	12: 70,883,762	Y219H	probably damaging	Het
Fuca1	T	C	4: 135,925,644	V193A	possibly damaging	Het
Gm1141	G	C	X: 71,938,773	R296P	possibly damaging	Het
Gm7461	C	T	8: 4,677,769		noncoding transcript	Het
Gpc5	T	A	14: 115,552,239	N508K	possibly damaging	Het
Iqch	A	T	9: 63,425,382	D1019E	probably benign	Het
Isyna1	A	G	8: 70,594,708	Y27C	probably damaging	Het
Itgb8	T	G	12: 119,202,481	H105P	probably benign	Het
Kbtbd11	C	T	8: 15,027,572	P57L	probably benign	Het
Kcns3	A	C	12: 11,092,558	C47G	probably damaging	Het
Kif21b	A	T	1: 136,172,157		probably null	Het
Lama3	A	T	18: 12,419,245	H418L	possibly damaging	Het
Lrit3	A	G	3: 129,788,302	Y679H	probably damaging	Het
Lrrc19	T	A	4: 94,638,252	D356V	probably damaging	Het
Morc2b	A	G	17: 33,135,807	M997T	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Mtcl1	A	T	17: 66,338,142	S1886T	possibly damaging	Het
Myo7a	A	C	7: 98,085,466	L607R	probably damaging	Het
Myom2	T	A	8: 15,069,783	F180I	probably damaging	Het
Myt1l	G	A	12: 29,811,485	E89K	unknown	Het
Nek2	A	G	1: 191,831,317	N431S	probably benign	Het
Olfr1086	T	A	2: 86,676,529	H268L	possibly damaging	Het
Olfr169	A	T	16: 19,565,980	V301E	possibly damaging	Het
Oprm1	A	T	10: 6,832,604		probably null	Het
Oxsr1	A	G	9: 119,241,784		probably benign	Het
Pdgfrb	G	A	18: 61,078,648		probably null	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Ptgs2	A	G	1: 150,101,037	Q7R	probably benign	Het
Rab3d	A	G	9: 21,914,686	V144A	probably benign	Het
Ralgapb	T	A	2: 158,439,547	L167H	probably damaging	Het
Ranbp3	A	G	17: 56,708,200	T301A	possibly damaging	Het
Rasgrf1	G	A	9: 89,984,269	V587M	probably damaging	Het
Sec16b	A	G	1: 157,564,863		probably benign	Het
Sin3b	T	C	8: 72,753,536		probably benign	Het
Slc10a2	T	C	8: 5,098,562	S128G	probably benign	Het
Tbl1xr1	G	A	3: 22,210,401	V507I	probably benign	Het
Tmem8b	T	G	4: 43,669,896		probably null	Het
Trak1	A	T	9: 121,367,167	T22S	probably benign	Het
Trim30d	A	G	7: 104,487,655	I114T	probably damaging	Het
Ttc13	A	T	8: 124,674,366	S624T	probably damaging	Het
Ttn	T	C	2: 76,828,130		probably benign	Het
Vipr1	T	A	9: 121,660,171	Y99*	probably null	Het
Vmn1r210	T	C	13: 22,827,874	K81E	probably damaging	Het
Wwc1	T	C	11: 35,853,472	Y841C	probably benign	Het
Xrcc4	A	G	13: 90,000,905		probably benign	Het
Zdhhc22	A	T	12: 86,988,297	I127N	probably damaging	Het
Zdhhc7	A	G	8: 120,088,046	L8P	possibly damaging	Het
Zfp664	C	A	5: 124,885,595	L18I	probably damaging	Het

Other mutations in Muc20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01953:Muc20	APN	16	32793703	missense	probably benign	0.10
IGL02016:Muc20	APN	16	32797352	missense	possibly damaging	0.46
IGL02092:Muc20	APN	16	32794272	missense	probably damaging	0.99
IGL02415:Muc20	APN	16	32794681	missense	unknown
R6669_muc20_072	UTSW	16	32793937	missense	possibly damaging	0.94
R0552:Muc20	UTSW	16	32793930	missense	probably damaging	0.98
R0669:Muc20	UTSW	16	32794480	missense	unknown
R0725:Muc20	UTSW	16	32793488	missense	probably benign	0.05
R1676:Muc20	UTSW	16	32794279	missense	probably damaging	1.00
R1771:Muc20	UTSW	16	32793852	missense	probably damaging	0.97
R1778:Muc20	UTSW	16	32794141	missense	possibly damaging	0.49
R1967:Muc20	UTSW	16	32794242	missense	probably benign	0.03
R2104:Muc20	UTSW	16	32794177	missense	probably damaging	0.99
R3054:Muc20	UTSW	16	32779029	missense	probably benign	0.18
R4704:Muc20	UTSW	16	32779074	missense	possibly damaging	0.70
R4893:Muc20	UTSW	16	32794672	missense	possibly damaging	0.66
R4986:Muc20	UTSW	16	32777635	intron	probably benign
R5191:Muc20	UTSW	16	32794476	missense	unknown
R5195:Muc20	UTSW	16	32794476	missense	unknown
R5875:Muc20	UTSW	16	32793819	missense	possibly damaging	0.93
R5931:Muc20	UTSW	16	32794574	missense	possibly damaging	0.81
R6434:Muc20	UTSW	16	32794806	missense	probably benign	0.01
R6523:Muc20	UTSW	16	32793450	missense	possibly damaging	0.90
R6580:Muc20	UTSW	16	32793489	missense	possibly damaging	0.77
R6669:Muc20	UTSW	16	32793937	missense	possibly damaging	0.94
R7028:Muc20	UTSW	16	32794246	missense	probably benign	0.03
R7681:Muc20	UTSW	16	32793619	missense	probably benign	0.34
R7722:Muc20	UTSW	16	32797386	missense	probably benign	0.00
R8678:Muc20	UTSW	16	32797419	start gained	probably benign
R8730:Muc20	UTSW	16	32779116	missense	probably benign	0.03
R8838:Muc20	UTSW	16	32793459	missense	possibly damaging	0.64
R9017:Muc20	UTSW	16	32794470	missense	unknown
R9230:Muc20	UTSW	16	32793214	missense	probably damaging	1.00
R9368:Muc20	UTSW	16	32794101	missense	possibly damaging	0.69
R9474:Muc20	UTSW	16	32794083	missense	probably damaging	1.00
R9486:Muc20	UTSW	16	32794878	missense	possibly damaging	0.92
R9603:Muc20	UTSW	16	32794785	missense	probably damaging	0.97
R9710:Muc20	UTSW	16	32794896	missense	possibly damaging	0.92
W0251:Muc20	UTSW	16	32793853	missense	possibly damaging	0.91
X0011:Muc20	UTSW	16	32793252	missense	possibly damaging	0.79

Predicted Primers

PCR Primer
(F):5'- ACCCACCAGGAGGTCATGAAATGC -3'
(R):5'- TCGGTGACAGTTAGAAGGAACCCC -3'

Sequencing Primer
(F):5'- CCTTATCCAAGCAGTGGATGC -3'
(R):5'- TTAGAAGGAACCCCCTGGAAAAC -3'

Posted On

2013-07-11