Mutagenetix > Incidental Mutations

Incidental Mutation 'R7452:Sstr1'

577820

Institutional Source

Beutler Lab

Gene Symbol

Sstr1

Ensembl Gene

ENSMUSG00000035431

Gene Name

somatostatin receptor 1

Synonyms

Smstr-1, sst1, Smstr1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7452 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58211772-58214444 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58213356 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 255 (L255P)

Ref Sequence

ENSEMBL: ENSMUSP00000037045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044299] [ENSMUST00000110671]

AlphaFold

P30873

Predicted Effect

probably damaging
Transcript: ENSMUST00000044299
AA Change: L255P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000037045
Gene: ENSMUSG00000035431
AA Change: L255P

Domain	Start	End	E-Value	Type
low complexity region	8	20	N/A	INTRINSIC
Pfam:7TM_GPCR_Srx	66	297	4.9e-8	PFAM
Pfam:7TM_GPCR_Srsx	69	338	2.7e-14	PFAM
Pfam:7tm_1	75	323	2.2e-65	PFAM
Pfam:7TM_GPCR_Srv	131	339	1.9e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000110671
AA Change: L255P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106299
Gene: ENSMUSG00000035431
AA Change: L255P

Domain	Start	End	E-Value	Type
low complexity region	8	20	N/A	INTRINSIC
Pfam:7TM_GPCR_Srx	66	299	4.8e-8	PFAM
Pfam:7TM_GPCR_Srsx	69	338	2.7e-14	PFAM
Pfam:7tm_1	75	323	4.1e-70	PFAM
Pfam:7TM_GPCR_Srv	131	339	1.8e-11	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. The protein encoded by this gene is a member of the superfamily of somatostatin receptors having seven transmembrane segments. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This somatostatin receptor has greater affinity for somatostatin-14 than -28. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display abnormal eye electrophysiology. Mice homozygous for a second targeted mutation display hypoactivity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	G	7: 34,245,671	S595P	probably benign	Het
A2m	C	A	6: 121,641,332	Q195K	probably damaging	Het
Abcg4	C	T	9: 44,279,600	G249R	probably damaging	Het
Actn1	T	C	12: 80,183,602	T293A	probably benign	Het
Adamts5	T	A	16: 85,877,981	T432S	probably benign	Het
Adh5	A	G	3: 138,454,745	T347A	probably benign	Het
Agbl5	A	G	5: 30,893,391	D432G	probably damaging	Het
Ank3	A	G	10: 69,899,051	T797A	possibly damaging	Het
Aoc1	T	G	6: 48,908,790	V743G	probably benign	Het
Arap2	A	T	5: 62,676,549	S858R	probably benign	Het
Arid1a	A	C	4: 133,753,127	V162G	possibly damaging	Het
Armc9	A	G	1: 86,213,092	D588G	possibly damaging	Het
Art3	A	G	5: 92,392,680	Y94C	probably damaging	Het
Btaf1	T	A	19: 36,969,127	D444E	probably damaging	Het
Cav2	A	G	6: 17,282,076	H111R	probably damaging	Het
Ccdc148	A	G	2: 58,827,584	L469P	probably damaging	Het
Celsr2	T	A	3: 108,413,090	E802V	possibly damaging	Het
Cfap57	T	C	4: 118,595,784	D574G	probably damaging	Het
Chd7	A	C	4: 8,854,731	D2024A	probably benign	Het
Corin	T	A	5: 72,435,247	D269V	possibly damaging	Het
Cyp4a12a	A	T	4: 115,327,598	I359F	probably damaging	Het
Defb6	T	C	8: 19,225,524	L7P	probably damaging	Het
Dnah7c	A	T	1: 46,647,036	M1817L	possibly damaging	Het
Dock3	A	G	9: 106,989,465	F682S	probably damaging	Het
Enpep	T	A	3: 129,271,403	Y879F	possibly damaging	Het
Enpp2	T	C	15: 54,866,736	N462S	probably damaging	Het
Ephb3	T	C	16: 21,217,357		probably null	Het
F7	C	T	8: 13,035,215	H414Y	probably benign	Het
Fbn1	T	C	2: 125,505,455	H50R	possibly damaging	Het
Fig4	T	C	10: 41,240,637	D586G	possibly damaging	Het
Fryl	A	G	5: 73,023,988	L2825P	probably damaging	Het
Gal3st2	T	A	1: 93,872,518	H30Q	possibly damaging	Het
Gm12886	G	A	4: 121,417,474	Q70*	probably null	Het
Gm8104	A	C	14: 43,110,044	T190P	probably benign	Het
Hps3	A	T	3: 20,011,428	N749K	probably damaging	Het
Hr	A	G	14: 70,571,486	T1101A	probably damaging	Het
Htatip2	T	A	7: 49,773,326	S210T	probably benign	Het
Ift80	T	C	3: 68,994,282		probably null	Het
Iqgap1	A	G	7: 80,760,829	V212A	possibly damaging	Het
Itih5	A	G	2: 10,238,796	E448G	probably damaging	Het
Kdm5b	T	C	1: 134,624,948	C1221R	probably damaging	Het
Lrrc72	T	C	12: 36,212,693	Y52C	probably benign	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
Mdn1	T	C	4: 32,739,030	I3617T	possibly damaging	Het
Mtpap	T	A	18: 4,379,705	H98Q	possibly damaging	Het
Nemf	A	T	12: 69,337,959		probably null	Het
Neto1	A	T	18: 86,498,931	I458L	probably benign	Het
Nfam1	T	A	15: 83,014,962	M128L	probably benign	Het
Olfr1279	A	G	2: 111,306,921	T239A	probably damaging	Het
Olfr1383	C	A	11: 49,524,381	H219Q	probably benign	Het
Olfr501-ps1	C	T	7: 108,508,593	T179I	unknown	Het
Olfr914	A	T	9: 38,607,088	I208F	probably benign	Het
P2ry14	C	T	3: 59,116,045	G7D	probably benign	Het
Pde11a	A	G	2: 76,136,414	Y564H	probably damaging	Het
Pex5l	C	T	3: 33,004,318	V262I	probably benign	Het
Poli	A	G	18: 70,508,978	V717A	possibly damaging	Het
Prdm14	A	T	1: 13,125,559	W93R	probably damaging	Het
Rbm46	T	C	3: 82,864,121	M396V	probably benign	Het
Rcor2	T	C	19: 7,271,222	V212A	probably benign	Het
Rcor3	C	A	1: 192,137,876	G8V	probably damaging	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Skp2	T	A	15: 9,113,832	Q366L	probably damaging	Het
Slc13a3	A	T	2: 165,427,114	S312T	probably benign	Het
Steap3	T	C	1: 120,227,855	E458G	possibly damaging	Het
Sv2b	T	A	7: 75,147,713	D311V	probably damaging	Het
Tmem132b	A	G	5: 125,638,268	D347G	probably benign	Het
Tmem161a	A	G	8: 70,177,488	D108G	probably damaging	Het
Traf5	T	A	1: 191,999,831	I47F		Het
Trp53bp2	C	T	1: 182,446,568	Q95*	probably null	Het
Ttn	G	T	2: 76,877,143		probably null	Het
Usf3	T	C	16: 44,220,034	S1626P	probably benign	Het
Usp3	T	C	9: 66,566,898	R33G	probably benign	Het
Zbtb20	G	T	16: 43,610,676	A517S	probably damaging	Het

Other mutations in Sstr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Sstr1	APN	12	58212750	missense	probably benign
IGL01975:Sstr1	APN	12	58213626	missense	probably benign	0.01
R0019:Sstr1	UTSW	12	58213149	missense	probably damaging	1.00
R0019:Sstr1	UTSW	12	58213149	missense	probably damaging	1.00
R0026:Sstr1	UTSW	12	58212858	missense	probably damaging	1.00
R0083:Sstr1	UTSW	12	58213742	missense	possibly damaging	0.85
R1218:Sstr1	UTSW	12	58213620	missense	possibly damaging	0.68
R1254:Sstr1	UTSW	12	58213322	missense	possibly damaging	0.93
R1815:Sstr1	UTSW	12	58213478	missense	possibly damaging	0.81
R2318:Sstr1	UTSW	12	58212776	missense	possibly damaging	0.77
R4588:Sstr1	UTSW	12	58213631	missense	probably benign	0.00
R5041:Sstr1	UTSW	12	58213155	missense	possibly damaging	0.94
R6556:Sstr1	UTSW	12	58213692	missense	possibly damaging	0.94
R7332:Sstr1	UTSW	12	58213386	missense	probably damaging	1.00
R7342:Sstr1	UTSW	12	58213670	missense	possibly damaging	0.95
R7380:Sstr1	UTSW	12	58213280	missense	probably benign	0.01
R7873:Sstr1	UTSW	12	58213527	missense	probably damaging	1.00
R9036:Sstr1	UTSW	12	58212783	missense	possibly damaging	0.92
R9095:Sstr1	UTSW	12	58212834	missense	probably damaging	1.00
Z1176:Sstr1	UTSW	12	58213526	missense	possibly damaging	0.72

Predicted Primers

PCR Primer
(F):5'- ATCGTGGTCTTCTCACGCAC -3'
(R):5'- AAGAGCGCTTGAAGTTGTCCG -3'

Sequencing Primer
(F):5'- GTCTTCTCACGCACCGCAG -3'
(R):5'- CGCTTGAAGTTGTCCGACAGG -3'

Posted On

2019-10-07