Mutagenetix > Incidental Mutation

Incidental Mutation 'R7452:Zbtb20'

577829

Institutional Source

Beutler Lab

Gene Symbol

Zbtb20

Ensembl Gene

ENSMUSG00000022708

Gene Name

zinc finger and BTB domain containing 20

Synonyms

Zfp288, D16Wsu73e, 7330412A13Rik, 1300017A20Rik, HOF, A930017C21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7452 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42875881-43642602 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 43610676 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 517 (A517S)

Ref Sequence

ENSEMBL: ENSMUSP00000110343 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079441] [ENSMUST00000114690] [ENSMUST00000114691] [ENSMUST00000114694] [ENSMUST00000114695] [ENSMUST00000146708] [ENSMUST00000148775] [ENSMUST00000156367] [ENSMUST00000156981]

AlphaFold

Q8K0L9

Predicted Effect

probably damaging
Transcript: ENSMUST00000079441
AA Change: A517S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000078410
Gene: ENSMUSG00000022708
AA Change: A517S

Domain	Start	End	E-Value	Type
BTB	104	197	2.04e-21	SMART
low complexity region	403	423	N/A	INTRINSIC
ZnF_C2H2	578	600	6.88e-4	SMART
ZnF_C2H2	606	628	4.17e-3	SMART
ZnF_C2H2	634	656	7.6e-6	SMART
ZnF_C2H2	662	684	5.06e-2	SMART
low complexity region	689	708	N/A	INTRINSIC
ZnF_C2H2	715	737	7.9e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114690
AA Change: A444S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110338
Gene: ENSMUSG00000022708
AA Change: A444S

Domain	Start	End	E-Value	Type
BTB	31	124	2.04e-21	SMART
low complexity region	330	350	N/A	INTRINSIC
ZnF_C2H2	505	527	6.88e-4	SMART
ZnF_C2H2	533	555	4.17e-3	SMART
ZnF_C2H2	561	583	7.6e-6	SMART
ZnF_C2H2	589	611	5.06e-2	SMART
low complexity region	616	635	N/A	INTRINSIC
ZnF_C2H2	642	664	7.9e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114691
AA Change: A444S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110339
Gene: ENSMUSG00000022708
AA Change: A444S

Domain	Start	End	E-Value	Type
BTB	31	124	2.04e-21	SMART
low complexity region	330	350	N/A	INTRINSIC
ZnF_C2H2	505	527	6.88e-4	SMART
ZnF_C2H2	533	555	4.17e-3	SMART
ZnF_C2H2	561	583	7.6e-6	SMART
ZnF_C2H2	589	611	5.06e-2	SMART
low complexity region	616	635	N/A	INTRINSIC
ZnF_C2H2	642	664	7.9e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114694
AA Change: A517S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110342
Gene: ENSMUSG00000022708
AA Change: A517S

Domain	Start	End	E-Value	Type
BTB	104	197	2.04e-21	SMART
low complexity region	403	423	N/A	INTRINSIC
ZnF_C2H2	578	600	6.88e-4	SMART
ZnF_C2H2	606	628	4.17e-3	SMART
ZnF_C2H2	634	656	7.6e-6	SMART
ZnF_C2H2	662	684	5.06e-2	SMART
low complexity region	689	708	N/A	INTRINSIC
ZnF_C2H2	715	737	7.9e-4	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000114695
AA Change: A517S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000110343
Gene: ENSMUSG00000022708
AA Change: A517S

Domain	Start	End	E-Value	Type
BTB	104	197	2.04e-21	SMART
low complexity region	403	423	N/A	INTRINSIC
ZnF_C2H2	578	600	6.88e-4	SMART
ZnF_C2H2	606	628	4.17e-3	SMART
ZnF_C2H2	634	656	7.6e-6	SMART
ZnF_C2H2	662	684	5.06e-2	SMART
low complexity region	689	708	N/A	INTRINSIC
ZnF_C2H2	715	737	7.9e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000146708

SMART Domains

Protein: ENSMUSP00000125233
Gene: ENSMUSG00000022708

Domain	Start	End	E-Value	Type
Pfam:BTB	21	74	3.7e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000148775

SMART Domains

Protein: ENSMUSP00000125016
Gene: ENSMUSG00000022708

Domain	Start	End	E-Value	Type
Pfam:BTB	21	60	9.8e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156367

SMART Domains

Protein: ENSMUSP00000124126
Gene: ENSMUSG00000022708

Domain	Start	End	E-Value	Type
Pfam:BTB	94	131	1.1e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156981

SMART Domains

Protein: ENSMUSP00000124189
Gene: ENSMUSG00000022708

Domain	Start	End	E-Value	Type
BTB	31	124	2.04e-21	SMART

Meta Mutation Damage Score

0.0937

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.8%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which was initially designated as dendritic cell-derived BTB/POZ zinc finger (DPZF), belongs to a family of transcription factors with an N-terminal BTB/POZ domain and a C-terminal DNA-bindng zinc finger domain. The BTB/POZ domain is a hydrophobic region of approximately 120 aa which mediates association with other BTB/POZ domain-containing proteins. This gene acts as a transcriptional repressor and plays a role in many processes including neurogenesis, glucose homeostasis, and postnatal growth. Mutations in this gene have been associated with Primrose syndrome as well as the 3q13.31 microdeletion syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, disrupted homeostasis, and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406P16Rik	A	G	7: 34,245,671	S595P	probably benign	Het
A2m	C	A	6: 121,641,332	Q195K	probably damaging	Het
Abcg4	C	T	9: 44,279,600	G249R	probably damaging	Het
Actn1	T	C	12: 80,183,602	T293A	probably benign	Het
Adamts5	T	A	16: 85,877,981	T432S	probably benign	Het
Adh5	A	G	3: 138,454,745	T347A	probably benign	Het
Agbl5	A	G	5: 30,893,391	D432G	probably damaging	Het
Ank3	A	G	10: 69,899,051	T797A	possibly damaging	Het
Aoc1	T	G	6: 48,908,790	V743G	probably benign	Het
Arap2	A	T	5: 62,676,549	S858R	probably benign	Het
Arid1a	A	C	4: 133,753,127	V162G	possibly damaging	Het
Armc9	A	G	1: 86,213,092	D588G	possibly damaging	Het
Art3	A	G	5: 92,392,680	Y94C	probably damaging	Het
Btaf1	T	A	19: 36,969,127	D444E	probably damaging	Het
Cav2	A	G	6: 17,282,076	H111R	probably damaging	Het
Ccdc148	A	G	2: 58,827,584	L469P	probably damaging	Het
Celsr2	T	A	3: 108,413,090	E802V	possibly damaging	Het
Cfap57	T	C	4: 118,595,784	D574G	probably damaging	Het
Chd7	A	C	4: 8,854,731	D2024A	probably benign	Het
Corin	T	A	5: 72,435,247	D269V	possibly damaging	Het
Cyp4a12a	A	T	4: 115,327,598	I359F	probably damaging	Het
Defb6	T	C	8: 19,225,524	L7P	probably damaging	Het
Dnah7c	A	T	1: 46,647,036	M1817L	possibly damaging	Het
Dock3	A	G	9: 106,989,465	F682S	probably damaging	Het
Enpep	T	A	3: 129,271,403	Y879F	possibly damaging	Het
Enpp2	T	C	15: 54,866,736	N462S	probably damaging	Het
Ephb3	T	C	16: 21,217,357		probably null	Het
F7	C	T	8: 13,035,215	H414Y	probably benign	Het
Fbn1	T	C	2: 125,505,455	H50R	possibly damaging	Het
Fig4	T	C	10: 41,240,637	D586G	possibly damaging	Het
Fryl	A	G	5: 73,023,988	L2825P	probably damaging	Het
Gal3st2	T	A	1: 93,872,518	H30Q	possibly damaging	Het
Gm12886	G	A	4: 121,417,474	Q70*	probably null	Het
Gm8104	A	C	14: 43,110,044	T190P	probably benign	Het
Hps3	A	T	3: 20,011,428	N749K	probably damaging	Het
Hr	A	G	14: 70,571,486	T1101A	probably damaging	Het
Htatip2	T	A	7: 49,773,326	S210T	probably benign	Het
Ift80	T	C	3: 68,994,282		probably null	Het
Iqgap1	A	G	7: 80,760,829	V212A	possibly damaging	Het
Itih5	A	G	2: 10,238,796	E448G	probably damaging	Het
Kdm5b	T	C	1: 134,624,948	C1221R	probably damaging	Het
Lrrc72	T	C	12: 36,212,693	Y52C	probably benign	Het
Map1b	C	T	13: 99,508,140	R85Q	probably damaging	Het
Mdn1	T	C	4: 32,739,030	I3617T	possibly damaging	Het
Mtpap	T	A	18: 4,379,705	H98Q	possibly damaging	Het
Nemf	A	T	12: 69,337,959		probably null	Het
Neto1	A	T	18: 86,498,931	I458L	probably benign	Het
Nfam1	T	A	15: 83,014,962	M128L	probably benign	Het
Olfr1279	A	G	2: 111,306,921	T239A	probably damaging	Het
Olfr1383	C	A	11: 49,524,381	H219Q	probably benign	Het
Olfr501-ps1	C	T	7: 108,508,593	T179I	unknown	Het
Olfr914	A	T	9: 38,607,088	I208F	probably benign	Het
P2ry14	C	T	3: 59,116,045	G7D	probably benign	Het
Pde11a	A	G	2: 76,136,414	Y564H	probably damaging	Het
Pex5l	C	T	3: 33,004,318	V262I	probably benign	Het
Poli	A	G	18: 70,508,978	V717A	possibly damaging	Het
Prdm14	A	T	1: 13,125,559	W93R	probably damaging	Het
Rbm46	T	C	3: 82,864,121	M396V	probably benign	Het
Rcor2	T	C	19: 7,271,222	V212A	probably benign	Het
Rcor3	C	A	1: 192,137,876	G8V	probably damaging	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rictor	C	T	15: 6,772,154	S441L	probably benign	Het
Skp2	T	A	15: 9,113,832	Q366L	probably damaging	Het
Slc13a3	A	T	2: 165,427,114	S312T	probably benign	Het
Sstr1	T	C	12: 58,213,356	L255P	probably damaging	Het
Steap3	T	C	1: 120,227,855	E458G	possibly damaging	Het
Sv2b	T	A	7: 75,147,713	D311V	probably damaging	Het
Tmem132b	A	G	5: 125,638,268	D347G	probably benign	Het
Tmem161a	A	G	8: 70,177,488	D108G	probably damaging	Het
Traf5	T	A	1: 191,999,831	I47F		Het
Trp53bp2	C	T	1: 182,446,568	Q95*	probably null	Het
Ttn	G	T	2: 76,877,143		probably null	Het
Usf3	T	C	16: 44,220,034	S1626P	probably benign	Het
Usp3	T	C	9: 66,566,898	R33G	probably benign	Het

Other mutations in Zbtb20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01761:Zbtb20	APN	16	43610661	missense	possibly damaging	0.85
IGL02170:Zbtb20	APN	16	43609662	missense	possibly damaging	0.84
IGL02292:Zbtb20	APN	16	43610648	nonsense	probably null
IGL02733:Zbtb20	APN	16	43609933	missense	possibly damaging	0.48
IGL03277:Zbtb20	APN	16	43618437	missense	possibly damaging	0.95
siberian	UTSW	16	43610676	missense	probably damaging	0.96
Tiger	UTSW	16	43618398	missense	probably damaging	0.98
Towering	UTSW	16	43610867	nonsense	probably null
R0310:Zbtb20	UTSW	16	43609746	missense	probably damaging	0.98
R1593:Zbtb20	UTSW	16	43609423	missense	probably damaging	0.99
R1996:Zbtb20	UTSW	16	43610080	missense	probably damaging	0.98
R2018:Zbtb20	UTSW	16	43577652	missense	possibly damaging	0.86
R2050:Zbtb20	UTSW	16	43609612	splice site	probably null
R2097:Zbtb20	UTSW	16	43609519	missense	probably null	1.00
R4006:Zbtb20	UTSW	16	43609399	missense	probably damaging	1.00
R4708:Zbtb20	UTSW	16	43610676	missense	probably damaging	0.96
R4710:Zbtb20	UTSW	16	43610676	missense	probably damaging	0.96
R4835:Zbtb20	UTSW	16	43618398	missense	probably damaging	0.98
R4962:Zbtb20	UTSW	16	43618692	missense	probably damaging	0.99
R5531:Zbtb20	UTSW	16	43610867	nonsense	probably null
R7523:Zbtb20	UTSW	16	43610512	missense	probably benign	0.01
R8175:Zbtb20	UTSW	16	43577080	intron	probably benign
R8306:Zbtb20	UTSW	16	43618737	missense	probably damaging	0.99
R8811:Zbtb20	UTSW	16	43610494	missense	probably benign
R8922:Zbtb20	UTSW	16	43577605	missense	probably damaging	0.99
R9164:Zbtb20	UTSW	16	43610401	missense	probably benign	0.02
R9687:Zbtb20	UTSW	16	43609797	missense	possibly damaging	0.83
Z1176:Zbtb20	UTSW	16	43610530	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- AGTAACAGCTCCGATAAGGGC -3'
(R):5'- CAGAGAGTGCACTCATAAGGC -3'

Sequencing Primer
(F):5'- TCCGATAAGGGCGTCCTACAG -3'
(R):5'- AGAGAGTGCACTCATAAGGCTTTTTG -3'

Posted On

2019-10-07