Incidental Mutation 'R7452:Zbtb20'
ID577829
Institutional Source Beutler Lab
Gene Symbol Zbtb20
Ensembl Gene ENSMUSG00000022708
Gene Namezinc finger and BTB domain containing 20
SynonymsZfp288, D16Wsu73e, 7330412A13Rik, 1300017A20Rik, HOF, A930017C21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7452 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location42875881-43642602 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 43610676 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 517 (A517S)
Ref Sequence ENSEMBL: ENSMUSP00000110343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079441] [ENSMUST00000114690] [ENSMUST00000114691] [ENSMUST00000114694] [ENSMUST00000114695] [ENSMUST00000146708] [ENSMUST00000148775] [ENSMUST00000156367] [ENSMUST00000156981]
Predicted Effect probably damaging
Transcript: ENSMUST00000079441
AA Change: A517S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000078410
Gene: ENSMUSG00000022708
AA Change: A517S

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114690
AA Change: A444S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110338
Gene: ENSMUSG00000022708
AA Change: A444S

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
low complexity region 330 350 N/A INTRINSIC
ZnF_C2H2 505 527 6.88e-4 SMART
ZnF_C2H2 533 555 4.17e-3 SMART
ZnF_C2H2 561 583 7.6e-6 SMART
ZnF_C2H2 589 611 5.06e-2 SMART
low complexity region 616 635 N/A INTRINSIC
ZnF_C2H2 642 664 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114691
AA Change: A444S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110339
Gene: ENSMUSG00000022708
AA Change: A444S

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
low complexity region 330 350 N/A INTRINSIC
ZnF_C2H2 505 527 6.88e-4 SMART
ZnF_C2H2 533 555 4.17e-3 SMART
ZnF_C2H2 561 583 7.6e-6 SMART
ZnF_C2H2 589 611 5.06e-2 SMART
low complexity region 616 635 N/A INTRINSIC
ZnF_C2H2 642 664 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114694
AA Change: A517S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110342
Gene: ENSMUSG00000022708
AA Change: A517S

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114695
AA Change: A517S

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110343
Gene: ENSMUSG00000022708
AA Change: A517S

DomainStartEndE-ValueType
BTB 104 197 2.04e-21 SMART
low complexity region 403 423 N/A INTRINSIC
ZnF_C2H2 578 600 6.88e-4 SMART
ZnF_C2H2 606 628 4.17e-3 SMART
ZnF_C2H2 634 656 7.6e-6 SMART
ZnF_C2H2 662 684 5.06e-2 SMART
low complexity region 689 708 N/A INTRINSIC
ZnF_C2H2 715 737 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146708
SMART Domains Protein: ENSMUSP00000125233
Gene: ENSMUSG00000022708

DomainStartEndE-ValueType
Pfam:BTB 21 74 3.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148775
SMART Domains Protein: ENSMUSP00000125016
Gene: ENSMUSG00000022708

DomainStartEndE-ValueType
Pfam:BTB 21 60 9.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156367
SMART Domains Protein: ENSMUSP00000124126
Gene: ENSMUSG00000022708

DomainStartEndE-ValueType
Pfam:BTB 94 131 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156981
SMART Domains Protein: ENSMUSP00000124189
Gene: ENSMUSG00000022708

DomainStartEndE-ValueType
BTB 31 124 2.04e-21 SMART
Meta Mutation Damage Score 0.0937 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which was initially designated as dendritic cell-derived BTB/POZ zinc finger (DPZF), belongs to a family of transcription factors with an N-terminal BTB/POZ domain and a C-terminal DNA-bindng zinc finger domain. The BTB/POZ domain is a hydrophobic region of approximately 120 aa which mediates association with other BTB/POZ domain-containing proteins. This gene acts as a transcriptional repressor and plays a role in many processes including neurogenesis, glucose homeostasis, and postnatal growth. Mutations in this gene have been associated with Primrose syndrome as well as the 3q13.31 microdeletion syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, disrupted homeostasis, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,671 S595P probably benign Het
A2m C A 6: 121,641,332 Q195K probably damaging Het
Abcg4 C T 9: 44,279,600 G249R probably damaging Het
Actn1 T C 12: 80,183,602 T293A probably benign Het
Adamts5 T A 16: 85,877,981 T432S probably benign Het
Adh5 A G 3: 138,454,745 T347A probably benign Het
Agbl5 A G 5: 30,893,391 D432G probably damaging Het
Ank3 A G 10: 69,899,051 T797A possibly damaging Het
Aoc1 T G 6: 48,908,790 V743G probably benign Het
Arap2 A T 5: 62,676,549 S858R probably benign Het
Arid1a A C 4: 133,753,127 V162G possibly damaging Het
Armc9 A G 1: 86,213,092 D588G possibly damaging Het
Art3 A G 5: 92,392,680 Y94C probably damaging Het
Btaf1 T A 19: 36,969,127 D444E probably damaging Het
Cav2 A G 6: 17,282,076 H111R probably damaging Het
Ccdc148 A G 2: 58,827,584 L469P probably damaging Het
Celsr2 T A 3: 108,413,090 E802V possibly damaging Het
Cfap57 T C 4: 118,595,784 D574G probably damaging Het
Chd7 A C 4: 8,854,731 D2024A probably benign Het
Corin T A 5: 72,435,247 D269V possibly damaging Het
Cyp4a12a A T 4: 115,327,598 I359F probably damaging Het
Defb6 T C 8: 19,225,524 L7P probably damaging Het
Dnah7c A T 1: 46,647,036 M1817L possibly damaging Het
Dock3 A G 9: 106,989,465 F682S probably damaging Het
Enpep T A 3: 129,271,403 Y879F possibly damaging Het
Enpp2 T C 15: 54,866,736 N462S probably damaging Het
Ephb3 T C 16: 21,217,357 probably null Het
F7 C T 8: 13,035,215 H414Y probably benign Het
Fbn1 T C 2: 125,505,455 H50R possibly damaging Het
Fig4 T C 10: 41,240,637 D586G possibly damaging Het
Fryl A G 5: 73,023,988 L2825P probably damaging Het
Gal3st2 T A 1: 93,872,518 H30Q possibly damaging Het
Gm12886 G A 4: 121,417,474 Q70* probably null Het
Gm8104 A C 14: 43,110,044 T190P probably benign Het
Hps3 A T 3: 20,011,428 N749K probably damaging Het
Hr A G 14: 70,571,486 T1101A probably damaging Het
Htatip2 T A 7: 49,773,326 S210T probably benign Het
Ift80 T C 3: 68,994,282 probably null Het
Iqgap1 A G 7: 80,760,829 V212A possibly damaging Het
Itih5 A G 2: 10,238,796 E448G probably damaging Het
Kdm5b T C 1: 134,624,948 C1221R probably damaging Het
Lrrc72 T C 12: 36,212,693 Y52C probably benign Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mdn1 T C 4: 32,739,030 I3617T possibly damaging Het
Mtpap T A 18: 4,379,705 H98Q possibly damaging Het
Nemf A T 12: 69,337,959 probably null Het
Neto1 A T 18: 86,498,931 I458L probably benign Het
Nfam1 T A 15: 83,014,962 M128L probably benign Het
Olfr1279 A G 2: 111,306,921 T239A probably damaging Het
Olfr1383 C A 11: 49,524,381 H219Q probably benign Het
Olfr501-ps1 C T 7: 108,508,593 T179I unknown Het
Olfr914 A T 9: 38,607,088 I208F probably benign Het
P2ry14 C T 3: 59,116,045 G7D probably benign Het
Pde11a A G 2: 76,136,414 Y564H probably damaging Het
Pex5l C T 3: 33,004,318 V262I probably benign Het
Poli A G 18: 70,508,978 V717A possibly damaging Het
Prdm14 A T 1: 13,125,559 W93R probably damaging Het
Rbm46 T C 3: 82,864,121 M396V probably benign Het
Rcor2 T C 19: 7,271,222 V212A probably benign Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Skp2 T A 15: 9,113,832 Q366L probably damaging Het
Slc13a3 A T 2: 165,427,114 S312T probably benign Het
Sstr1 T C 12: 58,213,356 L255P probably damaging Het
Steap3 T C 1: 120,227,855 E458G possibly damaging Het
Sv2b T A 7: 75,147,713 D311V probably damaging Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a A G 8: 70,177,488 D108G probably damaging Het
Traf5 T A 1: 191,999,831 I47F Het
Trp53bp2 C T 1: 182,446,568 Q95* probably null Het
Ttn G T 2: 76,877,143 probably null Het
Usf3 T C 16: 44,220,034 S1626P probably benign Het
Usp3 T C 9: 66,566,898 R33G probably benign Het
Other mutations in Zbtb20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Zbtb20 APN 16 43610661 missense possibly damaging 0.85
IGL02170:Zbtb20 APN 16 43609662 missense possibly damaging 0.84
IGL02292:Zbtb20 APN 16 43610648 nonsense probably null
IGL02733:Zbtb20 APN 16 43609933 missense possibly damaging 0.48
IGL03277:Zbtb20 APN 16 43618437 missense possibly damaging 0.95
siberian UTSW 16 43610676 missense probably damaging 0.96
Tiger UTSW 16 43618398 missense probably damaging 0.98
Towering UTSW 16 43610867 nonsense probably null
R0310:Zbtb20 UTSW 16 43609746 missense probably damaging 0.98
R1593:Zbtb20 UTSW 16 43609423 missense probably damaging 0.99
R1996:Zbtb20 UTSW 16 43610080 missense probably damaging 0.98
R2018:Zbtb20 UTSW 16 43577652 missense possibly damaging 0.86
R2050:Zbtb20 UTSW 16 43609612 unclassified probably null
R2097:Zbtb20 UTSW 16 43609519 missense probably null 1.00
R4006:Zbtb20 UTSW 16 43609399 missense probably damaging 1.00
R4708:Zbtb20 UTSW 16 43610676 missense probably damaging 0.96
R4710:Zbtb20 UTSW 16 43610676 missense probably damaging 0.96
R4835:Zbtb20 UTSW 16 43618398 missense probably damaging 0.98
R4962:Zbtb20 UTSW 16 43618692 missense probably damaging 0.99
R5531:Zbtb20 UTSW 16 43610867 nonsense probably null
R7523:Zbtb20 UTSW 16 43610512 missense probably benign 0.01
R8175:Zbtb20 UTSW 16 43577080 intron probably benign
R8306:Zbtb20 UTSW 16 43618737 missense probably damaging 0.99
Z1176:Zbtb20 UTSW 16 43610530 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- AGTAACAGCTCCGATAAGGGC -3'
(R):5'- CAGAGAGTGCACTCATAAGGC -3'

Sequencing Primer
(F):5'- TCCGATAAGGGCGTCCTACAG -3'
(R):5'- AGAGAGTGCACTCATAAGGCTTTTTG -3'
Posted On2019-10-07