Incidental Mutation 'R0629:Morc2b'
ID57783
Institutional Source Beutler Lab
Gene Symbol Morc2b
Ensembl Gene ENSMUSG00000048602
Gene Namemicrorchidia 2B
Synonyms
MMRRC Submission 038818-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R0629 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33135588-33139683 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33135807 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 997 (M997T)
Ref Sequence ENSEMBL: ENSMUSP00000123354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053896] [ENSMUST00000131954]
Predicted Effect probably benign
Transcript: ENSMUST00000053896
AA Change: M997T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000056879
Gene: ENSMUSG00000048602
AA Change: M997T

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 495 541 1.9e-16 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131954
AA Change: M997T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123354
Gene: ENSMUSG00000048602
AA Change: M997T

DomainStartEndE-ValueType
HATPase_c 24 134 5.78e0 SMART
coiled coil region 285 321 N/A INTRINSIC
Pfam:zf-CW 494 543 7.7e-18 PFAM
coiled coil region 555 584 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
coiled coil region 961 1001 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display male and female infertility with failure of chromosomal synapsis, double strand break repair, and recombination in meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Morc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Morc2b APN 17 33137319 missense possibly damaging 0.47
IGL01369:Morc2b APN 17 33138165 missense probably benign 0.12
IGL01533:Morc2b APN 17 33135721 utr 3 prime probably benign
IGL02003:Morc2b APN 17 33138324 missense probably benign 0.07
IGL02028:Morc2b APN 17 33137413 missense possibly damaging 0.78
IGL02152:Morc2b APN 17 33137943 missense probably damaging 1.00
IGL02341:Morc2b APN 17 33137307 missense probably damaging 1.00
IGL02976:Morc2b APN 17 33137523 missense possibly damaging 0.90
IGL03293:Morc2b APN 17 33138363 missense probably damaging 1.00
PIT4283001:Morc2b UTSW 17 33136068 missense probably benign 0.00
R0056:Morc2b UTSW 17 33138759 missense possibly damaging 0.78
R0116:Morc2b UTSW 17 33137041 missense probably damaging 1.00
R0179:Morc2b UTSW 17 33136982 nonsense probably null
R0533:Morc2b UTSW 17 33135932 nonsense probably null
R0556:Morc2b UTSW 17 33137838 missense probably benign 0.05
R0635:Morc2b UTSW 17 33137687 missense possibly damaging 0.90
R0840:Morc2b UTSW 17 33136112 missense probably benign 0.01
R1205:Morc2b UTSW 17 33135934 missense probably damaging 1.00
R1566:Morc2b UTSW 17 33136974 missense probably benign 0.02
R1676:Morc2b UTSW 17 33135981 missense possibly damaging 0.82
R1892:Morc2b UTSW 17 33135774 missense probably damaging 1.00
R1954:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1955:Morc2b UTSW 17 33137490 missense probably damaging 1.00
R1969:Morc2b UTSW 17 33137091 missense probably benign 0.00
R2069:Morc2b UTSW 17 33136760 missense probably benign 0.13
R3609:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3610:Morc2b UTSW 17 33136278 missense probably damaging 1.00
R3831:Morc2b UTSW 17 33137259 missense probably benign 0.01
R4156:Morc2b UTSW 17 33138427 missense probably benign 0.43
R4243:Morc2b UTSW 17 33136401 missense probably benign 0.03
R4877:Morc2b UTSW 17 33138738 missense probably benign 0.26
R4911:Morc2b UTSW 17 33137377 missense probably damaging 1.00
R5230:Morc2b UTSW 17 33136252 missense probably benign 0.00
R5264:Morc2b UTSW 17 33138379 missense probably benign 0.03
R5326:Morc2b UTSW 17 33136933 missense probably benign 0.01
R5455:Morc2b UTSW 17 33138610 missense probably benign 0.29
R5933:Morc2b UTSW 17 33138609 missense possibly damaging 0.84
R5973:Morc2b UTSW 17 33137472 missense probably damaging 0.97
R6026:Morc2b UTSW 17 33137983 missense possibly damaging 0.55
R6113:Morc2b UTSW 17 33138068 nonsense probably null
R6393:Morc2b UTSW 17 33137776 missense probably damaging 0.97
R7066:Morc2b UTSW 17 33136636 missense probably benign 0.00
R7117:Morc2b UTSW 17 33137952 missense probably benign 0.00
R7120:Morc2b UTSW 17 33135813 missense probably damaging 1.00
R7130:Morc2b UTSW 17 33136288 missense possibly damaging 0.68
R7498:Morc2b UTSW 17 33137859 missense possibly damaging 0.55
R7516:Morc2b UTSW 17 33137461 missense probably benign 0.03
R7664:Morc2b UTSW 17 33136402 missense probably benign 0.12
Z1088:Morc2b UTSW 17 33136086 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AGGCAGCTCAGGACCTCTCATAAC -3'
(R):5'- ATGCTTCTGCACTGAACCCGAC -3'

Sequencing Primer
(F):5'- ggacctctcataactttagttctttg -3'
(R):5'- TCCCTCTGAAAGAGTGCTTCAAG -3'
Posted On2013-07-11