Incidental Mutation 'R7452:Poli'
ID 577833
Institutional Source Beutler Lab
Gene Symbol Poli
Ensembl Gene ENSMUSG00000038425
Gene Name polymerase (DNA directed), iota
Synonyms Rad30b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7452 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 70508680-70530620 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70508978 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 717 (V717A)
Ref Sequence ENSEMBL: ENSMUSP00000112563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043286] [ENSMUST00000121674] [ENSMUST00000159389] [ENSMUST00000160713] [ENSMUST00000161542]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000043286
AA Change: V654A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039869
Gene: ENSMUSG00000038425
AA Change: V654A

DomainStartEndE-ValueType
Pfam:IMS 1 168 5.4e-39 PFAM
Pfam:IMS_HHH 180 212 1.2e-9 PFAM
Pfam:IMS_C 247 379 1.7e-12 PFAM
PDB:2KWV|A 444 489 8e-23 PDB
low complexity region 532 546 N/A INTRINSIC
PDB:3AI4|A 623 674 4e-26 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000121674
AA Change: V717A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112563
Gene: ENSMUSG00000038425
AA Change: V717A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:IMS 53 231 1e-47 PFAM
Pfam:IMS_HHH 243 275 1.5e-9 PFAM
Pfam:IMS_C 312 441 2.5e-14 PFAM
PDB:2KWV|A 507 552 8e-23 PDB
low complexity region 595 609 N/A INTRINSIC
PDB:3AI4|A 686 737 5e-26 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000159389
AA Change: V631A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000123964
Gene: ENSMUSG00000038425
AA Change: V631A

DomainStartEndE-ValueType
Pfam:IMS 1 145 1.8e-29 PFAM
Pfam:IMS_HHH 157 189 1.7e-9 PFAM
Pfam:IMS_C 224 356 2.4e-12 PFAM
PDB:2KWV|A 421 466 7e-23 PDB
low complexity region 509 523 N/A INTRINSIC
PDB:3AI4|A 600 651 3e-26 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160713
SMART Domains Protein: ENSMUSP00000125467
Gene: ENSMUSG00000038425

DomainStartEndE-ValueType
Pfam:IMS 1 127 5.9e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161542
AA Change: V654A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124877
Gene: ENSMUSG00000038425
AA Change: V654A

DomainStartEndE-ValueType
Pfam:IMS 1 168 5.4e-39 PFAM
Pfam:IMS_HHH 180 212 1.2e-9 PFAM
Pfam:IMS_C 247 379 1.7e-12 PFAM
PDB:2KWV|A 444 489 8e-23 PDB
low complexity region 532 546 N/A INTRINSIC
PDB:3AI4|A 623 674 4e-26 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation show normal somatic hypermutation of immunoglobulin variable genes and no significant increase in UV-induced epithelial skin tumor formation relative to controls; in contrast, formation of mesenchymal tumors by chronic UV irradiation is enhanced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,245,671 S595P probably benign Het
A2m C A 6: 121,641,332 Q195K probably damaging Het
Abcg4 C T 9: 44,279,600 G249R probably damaging Het
Actn1 T C 12: 80,183,602 T293A probably benign Het
Adamts5 T A 16: 85,877,981 T432S probably benign Het
Adh5 A G 3: 138,454,745 T347A probably benign Het
Agbl5 A G 5: 30,893,391 D432G probably damaging Het
Ank3 A G 10: 69,899,051 T797A possibly damaging Het
Aoc1 T G 6: 48,908,790 V743G probably benign Het
Arap2 A T 5: 62,676,549 S858R probably benign Het
Arid1a A C 4: 133,753,127 V162G possibly damaging Het
Armc9 A G 1: 86,213,092 D588G possibly damaging Het
Art3 A G 5: 92,392,680 Y94C probably damaging Het
Btaf1 T A 19: 36,969,127 D444E probably damaging Het
Cav2 A G 6: 17,282,076 H111R probably damaging Het
Ccdc148 A G 2: 58,827,584 L469P probably damaging Het
Celsr2 T A 3: 108,413,090 E802V possibly damaging Het
Cfap57 T C 4: 118,595,784 D574G probably damaging Het
Chd7 A C 4: 8,854,731 D2024A probably benign Het
Corin T A 5: 72,435,247 D269V possibly damaging Het
Cyp4a12a A T 4: 115,327,598 I359F probably damaging Het
Defb6 T C 8: 19,225,524 L7P probably damaging Het
Dnah7c A T 1: 46,647,036 M1817L possibly damaging Het
Dock3 A G 9: 106,989,465 F682S probably damaging Het
Enpep T A 3: 129,271,403 Y879F possibly damaging Het
Enpp2 T C 15: 54,866,736 N462S probably damaging Het
Ephb3 T C 16: 21,217,357 probably null Het
F7 C T 8: 13,035,215 H414Y probably benign Het
Fbn1 T C 2: 125,505,455 H50R possibly damaging Het
Fig4 T C 10: 41,240,637 D586G possibly damaging Het
Fryl A G 5: 73,023,988 L2825P probably damaging Het
Gal3st2 T A 1: 93,872,518 H30Q possibly damaging Het
Gm12886 G A 4: 121,417,474 Q70* probably null Het
Gm8104 A C 14: 43,110,044 T190P probably benign Het
Hps3 A T 3: 20,011,428 N749K probably damaging Het
Hr A G 14: 70,571,486 T1101A probably damaging Het
Htatip2 T A 7: 49,773,326 S210T probably benign Het
Ift80 T C 3: 68,994,282 probably null Het
Iqgap1 A G 7: 80,760,829 V212A possibly damaging Het
Itih5 A G 2: 10,238,796 E448G probably damaging Het
Kdm5b T C 1: 134,624,948 C1221R probably damaging Het
Lrrc72 T C 12: 36,212,693 Y52C probably benign Het
Map1b C T 13: 99,508,140 R85Q probably damaging Het
Mdn1 T C 4: 32,739,030 I3617T possibly damaging Het
Mtpap T A 18: 4,379,705 H98Q possibly damaging Het
Nemf A T 12: 69,337,959 probably null Het
Neto1 A T 18: 86,498,931 I458L probably benign Het
Nfam1 T A 15: 83,014,962 M128L probably benign Het
Olfr1279 A G 2: 111,306,921 T239A probably damaging Het
Olfr1383 C A 11: 49,524,381 H219Q probably benign Het
Olfr501-ps1 C T 7: 108,508,593 T179I unknown Het
Olfr914 A T 9: 38,607,088 I208F probably benign Het
P2ry14 C T 3: 59,116,045 G7D probably benign Het
Pde11a A G 2: 76,136,414 Y564H probably damaging Het
Pex5l C T 3: 33,004,318 V262I probably benign Het
Prdm14 A T 1: 13,125,559 W93R probably damaging Het
Rbm46 T C 3: 82,864,121 M396V probably benign Het
Rcor2 T C 19: 7,271,222 V212A probably benign Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rictor C T 15: 6,772,154 S441L probably benign Het
Skp2 T A 15: 9,113,832 Q366L probably damaging Het
Slc13a3 A T 2: 165,427,114 S312T probably benign Het
Sstr1 T C 12: 58,213,356 L255P probably damaging Het
Steap3 T C 1: 120,227,855 E458G possibly damaging Het
Sv2b T A 7: 75,147,713 D311V probably damaging Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Tmem161a A G 8: 70,177,488 D108G probably damaging Het
Traf5 T A 1: 191,999,831 I47F Het
Trp53bp2 C T 1: 182,446,568 Q95* probably null Het
Ttn G T 2: 76,877,143 probably null Het
Usf3 T C 16: 44,220,034 S1626P probably benign Het
Usp3 T C 9: 66,566,898 R33G probably benign Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Other mutations in Poli
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Poli APN 18 70525490 missense probably damaging 1.00
IGL01506:Poli APN 18 70509731 missense probably benign
IGL01958:Poli APN 18 70526586 missense possibly damaging 0.46
IGL02375:Poli APN 18 70523292 missense probably damaging 1.00
IGL02385:Poli APN 18 70526574 missense possibly damaging 0.93
IGL02480:Poli APN 18 70525406 missense probably benign 0.04
R0113:Poli UTSW 18 70528758 missense probably damaging 1.00
R0184:Poli UTSW 18 70522731 missense probably damaging 1.00
R0348:Poli UTSW 18 70523381 missense probably benign 0.00
R0710:Poli UTSW 18 70522890 splice site probably null
R1004:Poli UTSW 18 70525438 missense probably benign 0.31
R1264:Poli UTSW 18 70517503 missense probably benign 0.05
R1660:Poli UTSW 18 70509464 missense probably damaging 0.99
R1992:Poli UTSW 18 70508987 missense probably damaging 0.98
R2915:Poli UTSW 18 70522700 critical splice donor site probably null
R4531:Poli UTSW 18 70517477 missense probably benign 0.41
R4816:Poli UTSW 18 70522751 missense probably damaging 1.00
R5393:Poli UTSW 18 70517428 nonsense probably null
R5404:Poli UTSW 18 70509432 missense probably benign 0.15
R5559:Poli UTSW 18 70509285 missense probably benign 0.02
R5957:Poli UTSW 18 70517440 missense probably benign
R6045:Poli UTSW 18 70517469 missense possibly damaging 0.75
R6385:Poli UTSW 18 70530001 start gained probably benign
R6807:Poli UTSW 18 70530151 splice site probably null
R7024:Poli UTSW 18 70516849 missense possibly damaging 0.68
R7067:Poli UTSW 18 70509417 nonsense probably null
R7653:Poli UTSW 18 70509627 missense probably benign
R7685:Poli UTSW 18 70525519 missense probably benign 0.13
R7857:Poli UTSW 18 70509154 missense probably benign 0.01
R7872:Poli UTSW 18 70522820 missense probably damaging 1.00
R9184:Poli UTSW 18 70509179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGAGAGCCTAGTGTTGACC -3'
(R):5'- CTCCACACATCGCACTGTAG -3'

Sequencing Primer
(F):5'- GAGCCTAGTGTTGACCATGATATTCC -3'
(R):5'- CTGGATTCTGCGGAAGAA -3'
Posted On 2019-10-07