Incidental Mutation 'R7453:Cflar'
ID 577839
Institutional Source Beutler Lab
Gene Symbol Cflar
Ensembl Gene ENSMUSG00000026031
Gene Name CASP8 and FADD-like apoptosis regulator
Synonyms Cash, c-Flip, Flip, 2310024N18Rik, Casper, A430105C05Rik
MMRRC Submission 045527-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7453 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 58750667-58798043 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 58792956 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 441 (V441M)
Ref Sequence ENSEMBL: ENSMUSP00000109952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069333] [ENSMUST00000097722] [ENSMUST00000114313]
AlphaFold O35732
Predicted Effect
SMART Domains Protein: ENSMUSP00000065107
Gene: ENSMUSG00000026031
AA Change: V441M

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 245 480 6.05e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097722
AA Change: V444M

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095329
Gene: ENSMUSG00000026031
AA Change: V444M

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 248 483 6.05e-92 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000109952
Gene: ENSMUSG00000026031
AA Change: V441M

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 245 480 6.05e-92 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (122/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulator of apoptosis and is structurally similar to caspase-8. However, the encoded protein lacks caspase activity and appears to be itself cleaved into two peptides by caspase-8. Several transcript variants encoding different isoforms have been found for this gene, and partial evidence for several more variants exists. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality by E10.5. Mutant embryos exhibit cardiac developmental abnormalities and pooling of blood in the head and abdominal regions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A G 2: 155,845,309 (GRCm39) S32P possibly damaging Het
Acaca T C 11: 84,136,136 (GRCm39) V497A probably benign Het
Acox1 T C 11: 116,071,787 (GRCm39) T214A probably benign Het
Adgrb2 G A 4: 129,908,430 (GRCm39) probably null Het
Adh1 G A 3: 137,995,702 (GRCm39) probably null Het
Angptl1 G T 1: 156,672,421 (GRCm39) M82I probably benign Het
Arg1 A G 10: 24,791,674 (GRCm39) L269P probably damaging Het
Arid2 T G 15: 96,268,605 (GRCm39) V906G probably benign Het
Arid5b A T 10: 68,078,994 (GRCm39) H114Q probably benign Het
Atad5 T C 11: 80,009,969 (GRCm39) probably null Het
AU040320 G A 4: 126,729,493 (GRCm39) probably null Het
B230104I21Rik A T 4: 154,432,185 (GRCm39) T44S unknown Het
BC024063 G A 10: 81,945,991 (GRCm39) R537H possibly damaging Het
Bfsp2 A T 9: 103,330,306 (GRCm39) L177Q probably damaging Het
Birc5 C A 11: 117,743,507 (GRCm39) H80Q probably damaging Het
Bpifb9a T C 2: 154,106,615 (GRCm39) L382P probably damaging Het
Ces2c A T 8: 105,576,302 (GRCm39) N105I probably benign Het
Cfap91 A G 16: 38,141,841 (GRCm39) S364P possibly damaging Het
Ckap4 A G 10: 84,364,463 (GRCm39) V200A probably damaging Het
Clec16a C A 16: 10,462,686 (GRCm39) T668N probably damaging Het
Cntrl A C 2: 35,045,421 (GRCm39) E1376D possibly damaging Het
Col18a1 A T 10: 76,921,044 (GRCm39) probably null Het
Coq2 T C 5: 100,811,452 (GRCm39) Y179C probably benign Het
Cpne6 A G 14: 55,749,473 (GRCm39) E11G probably benign Het
Cr2 A C 1: 194,847,565 (GRCm39) probably null Het
Csf2rb2 C T 15: 78,169,491 (GRCm39) D555N probably benign Het
Cyp2j12 A T 4: 95,990,363 (GRCm39) V401D possibly damaging Het
Dbp C T 7: 45,355,127 (GRCm39) A27V probably benign Het
Dll1 C A 17: 15,595,151 (GRCm39) R42L probably benign Het
Dst C A 1: 34,230,439 (GRCm39) H2677Q possibly damaging Het
Efl1 G T 7: 82,330,675 (GRCm39) V283F possibly damaging Het
Enah C T 1: 181,789,470 (GRCm39) C7Y unknown Het
Fam193a A T 5: 34,621,460 (GRCm39) E1139V possibly damaging Het
Fbn1 G A 2: 125,162,879 (GRCm39) P2136S possibly damaging Het
Fggy T C 4: 95,485,927 (GRCm39) V91A probably damaging Het
Fn1 T A 1: 71,630,039 (GRCm39) D2343V probably damaging Het
Galk2 T C 2: 125,729,781 (GRCm39) V54A possibly damaging Het
Glb1l T A 1: 75,179,350 (GRCm39) Y193F probably damaging Het
Gm45861 G T 8: 28,031,686 (GRCm39) R867L unknown Het
Grin2b T C 6: 135,717,947 (GRCm39) D715G possibly damaging Het
Hltf A T 3: 20,136,916 (GRCm39) R384S possibly damaging Het
Hs3st1 A G 5: 39,772,310 (GRCm39) M111T probably damaging Het
Idua A G 5: 108,829,362 (GRCm39) T388A probably benign Het
Kat14 T C 2: 144,222,654 (GRCm39) S136P possibly damaging Het
Kif24 A C 4: 41,394,673 (GRCm39) C867W possibly damaging Het
Klhdc10 T A 6: 30,447,989 (GRCm39) probably null Het
Klra10 A G 6: 130,257,327 (GRCm39) V59A probably damaging Het
Limk1 T A 5: 134,698,091 (GRCm39) I223F probably damaging Het
Lrp10 G A 14: 54,705,913 (GRCm39) G368S probably damaging Het
Lrrc7 T C 3: 157,891,046 (GRCm39) R374G probably benign Het
Lypd1 T A 1: 125,801,303 (GRCm39) M66L probably benign Het
Mast4 C T 13: 102,941,149 (GRCm39) probably null Het
Mbp C T 18: 82,572,768 (GRCm39) H155Y probably damaging Het
Micu3 G A 8: 40,788,939 (GRCm39) C150Y probably benign Het
Mras C T 9: 99,271,793 (GRCm39) V174I probably benign Het
Mroh1 T A 15: 76,317,745 (GRCm39) I827N probably damaging Het
Ms4a12 C A 19: 11,203,026 (GRCm39) G101* probably null Het
Mylk2 A T 2: 152,754,353 (GRCm39) K149M probably damaging Het
Myom3 T A 4: 135,528,346 (GRCm39) L1064I probably damaging Het
Naa30 A G 14: 49,425,144 (GRCm39) *365W probably null Het
Ncoa1 C T 12: 4,309,307 (GRCm39) G1330R probably damaging Het
Nhlh1 T A 1: 171,881,846 (GRCm39) T7S probably benign Het
Nipsnap3a A G 4: 52,995,882 (GRCm39) Q110R probably benign Het
Nostrin T C 2: 69,014,240 (GRCm39) Y399H possibly damaging Het
Nsfl1c C A 2: 151,351,431 (GRCm39) T263K possibly damaging Het
Nup153 T C 13: 46,834,657 (GRCm39) T1456A probably damaging Het
Or14j10 G T 17: 37,935,276 (GRCm39) D83E probably benign Het
Or1o2 T C 17: 37,542,871 (GRCm39) Y130C probably damaging Het
Or51e1 T A 7: 102,358,724 (GRCm39) I86N probably damaging Het
Or52z1 T A 7: 103,436,879 (GRCm39) I202F possibly damaging Het
Or5g26 T A 2: 85,494,524 (GRCm39) M85L probably benign Het
Or8d1b A T 9: 38,887,500 (GRCm39) H176L probably damaging Het
Pan3 G A 5: 147,463,491 (GRCm39) probably null Het
Pcdhgb2 C T 18: 37,824,068 (GRCm39) T353I probably damaging Het
Pcif1 A T 2: 164,730,284 (GRCm39) H339L probably damaging Het
Pcif1 A G 2: 164,731,550 (GRCm39) H501R possibly damaging Het
Pcnt T C 10: 76,225,284 (GRCm39) H1740R probably benign Het
Polr1b T A 2: 128,967,583 (GRCm39) I992N probably damaging Het
Ppfia2 C T 10: 106,763,691 (GRCm39) T1228M possibly damaging Het
Ppp2r5e A G 12: 75,509,116 (GRCm39) F388L probably damaging Het
Ptpre G T 7: 135,139,803 (GRCm39) R4L unknown Het
Pzp G T 6: 128,463,879 (GRCm39) P1410T probably damaging Het
Qrich1 A C 9: 108,433,675 (GRCm39) K656T possibly damaging Het
Rabep1 C T 11: 70,808,486 (GRCm39) P481S probably damaging Het
Rgs9 T A 11: 109,118,094 (GRCm39) R579W probably damaging Het
Rhot1 T C 11: 80,139,366 (GRCm39) probably null Het
Rnf123 T A 9: 107,947,607 (GRCm39) probably null Het
Rreb1 T G 13: 38,125,545 (GRCm39) C1284G probably damaging Het
Rsph4a A G 10: 33,785,289 (GRCm39) E400G probably benign Het
Rufy4 T A 1: 74,168,493 (GRCm39) probably null Het
S100pbp A G 4: 129,075,878 (GRCm39) L149P probably damaging Het
Sall3 T C 18: 81,015,255 (GRCm39) D891G probably benign Het
Scn10a C T 9: 119,467,618 (GRCm39) V841I probably benign Het
Scn5a T A 9: 119,351,656 (GRCm39) Y775F possibly damaging Het
Sec62 A T 3: 30,863,945 (GRCm39) probably null Het
Slc24a1 A T 9: 64,856,583 (GRCm39) M108K unknown Het
Spata22 T A 11: 73,226,816 (GRCm39) probably null Het
Spmap2l A G 5: 77,208,633 (GRCm39) H387R probably damaging Het
Stk4 A G 2: 163,928,522 (GRCm39) N118S probably benign Het
Stt3a A T 9: 36,659,266 (GRCm39) S358T possibly damaging Het
Tbc1d31 T A 15: 57,814,391 (GRCm39) F531I probably damaging Het
Tfrc A G 16: 32,437,867 (GRCm39) T307A probably damaging Het
Tnpo2 T C 8: 85,781,651 (GRCm39) I811T probably damaging Het
Ttc23l T C 15: 10,533,853 (GRCm39) Y230C probably damaging Het
Ttll13 A G 7: 79,910,182 (GRCm39) D775G probably benign Het
Ttn T C 2: 76,775,273 (GRCm39) K1969R unknown Het
Ube2s G A 7: 4,813,435 (GRCm39) R110* probably null Het
Ubxn11 G A 4: 133,853,540 (GRCm39) R364Q probably benign Het
Unc13d T C 11: 115,958,697 (GRCm39) Q773R probably benign Het
Ush2a T C 1: 188,285,308 (GRCm39) V1948A probably damaging Het
Vmn1r205 A T 13: 22,776,931 (GRCm39) I57N probably damaging Het
Vmn2r69 GAAAA GAAAAA 7: 85,060,768 (GRCm39) probably null Het
Vmn2r71 A T 7: 85,273,297 (GRCm39) T704S probably benign Het
Vmn2r93 T A 17: 18,533,580 (GRCm39) S495T probably benign Het
Wiz T A 17: 32,598,049 (GRCm39) I102F probably benign Het
Zan A C 5: 137,464,264 (GRCm39) L514V probably damaging Het
Zfp106 T A 2: 120,341,008 (GRCm39) N1857I probably damaging Het
Zfp106 A T 2: 120,376,400 (GRCm39) probably null Het
Zfp738 T C 13: 67,818,474 (GRCm39) T506A probably benign Het
Zfp934 T C 13: 62,666,517 (GRCm39) N53S probably benign Het
Other mutations in Cflar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cflar APN 1 58,771,469 (GRCm39) missense probably benign 0.42
IGL00959:Cflar APN 1 58,768,321 (GRCm39) critical splice donor site probably null
IGL02045:Cflar APN 1 58,791,903 (GRCm39) missense probably benign 0.25
IGL02200:Cflar APN 1 58,791,828 (GRCm39) missense probably damaging 1.00
IGL02382:Cflar APN 1 58,791,840 (GRCm39) missense probably benign 0.14
IGL03032:Cflar APN 1 58,780,179 (GRCm39) missense probably damaging 1.00
Channel_islands UTSW 1 58,793,010 (GRCm39) missense probably benign 0.00
IGL02988:Cflar UTSW 1 58,780,190 (GRCm39) missense possibly damaging 0.58
R1936:Cflar UTSW 1 58,791,784 (GRCm39) nonsense probably null
R2259:Cflar UTSW 1 58,768,280 (GRCm39) missense probably benign 0.16
R2269:Cflar UTSW 1 58,780,206 (GRCm39) critical splice donor site probably null
R3816:Cflar UTSW 1 58,791,582 (GRCm39) missense probably benign 0.24
R3824:Cflar UTSW 1 58,774,856 (GRCm39) missense probably benign 0.00
R4232:Cflar UTSW 1 58,780,152 (GRCm39) missense possibly damaging 0.92
R4644:Cflar UTSW 1 58,770,426 (GRCm39) missense probably damaging 1.00
R4749:Cflar UTSW 1 58,779,431 (GRCm39) missense possibly damaging 0.62
R4765:Cflar UTSW 1 58,771,480 (GRCm39) missense probably damaging 0.98
R4785:Cflar UTSW 1 58,791,726 (GRCm39) missense probably benign 0.34
R5315:Cflar UTSW 1 58,792,961 (GRCm39) missense probably benign 0.34
R5418:Cflar UTSW 1 58,791,810 (GRCm39) missense possibly damaging 0.54
R5509:Cflar UTSW 1 58,791,551 (GRCm39) missense probably benign 0.02
R5858:Cflar UTSW 1 58,793,010 (GRCm39) missense probably benign 0.00
R5899:Cflar UTSW 1 58,791,927 (GRCm39) missense probably benign 0.36
R6048:Cflar UTSW 1 58,780,202 (GRCm39) missense probably benign 0.02
R7065:Cflar UTSW 1 58,770,368 (GRCm39) missense probably damaging 1.00
R7144:Cflar UTSW 1 58,793,007 (GRCm39) missense
R7206:Cflar UTSW 1 58,780,150 (GRCm39) missense
R7384:Cflar UTSW 1 58,791,735 (GRCm39) missense
R7467:Cflar UTSW 1 58,765,597 (GRCm39) start codon destroyed probably null
R7694:Cflar UTSW 1 58,791,966 (GRCm39) missense
R7808:Cflar UTSW 1 58,750,740 (GRCm39) start gained probably benign
R7890:Cflar UTSW 1 58,791,915 (GRCm39) missense
R8073:Cflar UTSW 1 58,791,981 (GRCm39) missense
R9506:Cflar UTSW 1 58,791,975 (GRCm39) missense
Z1176:Cflar UTSW 1 58,779,472 (GRCm39) critical splice donor site probably null
Z1176:Cflar UTSW 1 58,770,388 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- GTTCTCAGAGTAAAATTCCACTGTC -3'
(R):5'- CCACCCTGGATGATATACCAAG -3'

Sequencing Primer
(F):5'- TGGGCCAGAGTACTGCCAATTG -3'
(R):5'- GAACACCAACGGTCTGGG -3'
Posted On 2019-10-07