Mutagenetix > Incidental Mutation

Incidental Mutation 'R0629:Aars2'

57784

Institutional Source

Beutler Lab

Gene Symbol

Aars2

Ensembl Gene

ENSMUSG00000023938

Gene Name

alanyl-tRNA synthetase 2, mitochondrial

Synonyms

Aarsl

MMRRC Submission

038818-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0629 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

45506841-45520842 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 45507547 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 86 (D86V)

Ref Sequence

ENSEMBL: ENSMUSP00000024733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024733]

AlphaFold

Q14CH7

Predicted Effect

probably damaging
Transcript: ENSMUST00000024733
AA Change: D86V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000024733
Gene: ENSMUSG00000023938
AA Change: D86V

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
Pfam:tRNA-synt_2c	36	619	4e-175	PFAM
low complexity region	663	674	N/A	INTRINSIC
tRNA_SAD	716	774	2.65e-10	SMART
coiled coil region	833	863	N/A	INTRINSIC

Meta Mutation Damage Score

0.6486

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. Aminoacyl-tRNA synthetases play critical roles in mRNA translation by charging tRNAs with their cognate amino acids. The encoded protein is a mitochondrial enzyme that specifically aminoacylates alanyl-tRNA. Mutations in this gene are a cause of combined oxidative phosphorylation deficiency 8. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts14	G	A	10: 61,211,624	Q733*	probably null	Het
Adcy10	A	G	1: 165,543,105	D651G	probably damaging	Het
Apcdd1	T	A	18: 62,933,970	C52S	probably damaging	Het
Bclaf1	T	C	10: 20,333,426	S463P	probably damaging	Het
Cabcoco1	T	C	10: 68,516,278	Y68C	probably damaging	Het
Cacna1f	G	A	X: 7,620,434	S888N	probably damaging	Het
Cacna1g	A	G	11: 94,409,543	C2134R	possibly damaging	Het
Cdc37	A	C	9: 21,140,768	M325R	possibly damaging	Het
Clca2	T	A	3: 145,072,239	M762L	probably benign	Het
Cntn3	C	T	6: 102,203,976	V753M	probably damaging	Het
Col6a6	A	T	9: 105,727,165		probably benign	Het
Dscaml1	A	G	9: 45,721,418	D1194G	probably damaging	Het
Egfr	G	A	11: 16,869,333	G288S	probably damaging	Het
Fbxl17	G	T	17: 63,471,414	N19K	probably damaging	Het
Fmo3	A	G	1: 162,958,227		probably benign	Het
Frmd6	T	C	12: 70,883,762	Y219H	probably damaging	Het
Fuca1	T	C	4: 135,925,644	V193A	possibly damaging	Het
Gm1141	G	C	X: 71,938,773	R296P	possibly damaging	Het
Gm7461	C	T	8: 4,677,769		noncoding transcript	Het
Gpc5	T	A	14: 115,552,239	N508K	possibly damaging	Het
Iqch	A	T	9: 63,425,382	D1019E	probably benign	Het
Isyna1	A	G	8: 70,594,708	Y27C	probably damaging	Het
Itgb8	T	G	12: 119,202,481	H105P	probably benign	Het
Kbtbd11	C	T	8: 15,027,572	P57L	probably benign	Het
Kcns3	A	C	12: 11,092,558	C47G	probably damaging	Het
Kif21b	A	T	1: 136,172,157		probably null	Het
Lama3	A	T	18: 12,419,245	H418L	possibly damaging	Het
Lrit3	A	G	3: 129,788,302	Y679H	probably damaging	Het
Lrrc19	T	A	4: 94,638,252	D356V	probably damaging	Het
Morc2b	A	G	17: 33,135,807	M997T	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Mtcl1	A	T	17: 66,338,142	S1886T	possibly damaging	Het
Muc20	T	C	16: 32,793,421	T529A	possibly damaging	Het
Myo7a	A	C	7: 98,085,466	L607R	probably damaging	Het
Myom2	T	A	8: 15,069,783	F180I	probably damaging	Het
Myt1l	G	A	12: 29,811,485	E89K	unknown	Het
Nek2	A	G	1: 191,831,317	N431S	probably benign	Het
Olfr1086	T	A	2: 86,676,529	H268L	possibly damaging	Het
Olfr169	A	T	16: 19,565,980	V301E	possibly damaging	Het
Oprm1	A	T	10: 6,832,604		probably null	Het
Oxsr1	A	G	9: 119,241,784		probably benign	Het
Pdgfrb	G	A	18: 61,078,648		probably null	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Ptgs2	A	G	1: 150,101,037	Q7R	probably benign	Het
Rab3d	A	G	9: 21,914,686	V144A	probably benign	Het
Ralgapb	T	A	2: 158,439,547	L167H	probably damaging	Het
Ranbp3	A	G	17: 56,708,200	T301A	possibly damaging	Het
Rasgrf1	G	A	9: 89,984,269	V587M	probably damaging	Het
Sec16b	A	G	1: 157,564,863		probably benign	Het
Sin3b	T	C	8: 72,753,536		probably benign	Het
Slc10a2	T	C	8: 5,098,562	S128G	probably benign	Het
Tbl1xr1	G	A	3: 22,210,401	V507I	probably benign	Het
Tmem8b	T	G	4: 43,669,896		probably null	Het
Trak1	A	T	9: 121,367,167	T22S	probably benign	Het
Trim30d	A	G	7: 104,487,655	I114T	probably damaging	Het
Ttc13	A	T	8: 124,674,366	S624T	probably damaging	Het
Ttn	T	C	2: 76,828,130		probably benign	Het
Vipr1	T	A	9: 121,660,171	Y99*	probably null	Het
Vmn1r210	T	C	13: 22,827,874	K81E	probably damaging	Het
Wwc1	T	C	11: 35,853,472	Y841C	probably benign	Het
Xrcc4	A	G	13: 90,000,905		probably benign	Het
Zdhhc22	A	T	12: 86,988,297	I127N	probably damaging	Het
Zdhhc7	A	G	8: 120,088,046	L8P	possibly damaging	Het
Zfp664	C	A	5: 124,885,595	L18I	probably damaging	Het

Other mutations in Aars2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02958:Aars2	APN	17	45518172	missense	probably benign	0.00
dread_pirate	UTSW	17	45516564	missense	probably damaging	1.00
R0266:Aars2	UTSW	17	45507510	splice site	probably benign
R0315:Aars2	UTSW	17	45515452	missense	possibly damaging	0.67
R0375:Aars2	UTSW	17	45514550	missense	probably damaging	0.99
R0981:Aars2	UTSW	17	45520331	missense	probably damaging	1.00
R1878:Aars2	UTSW	17	45514638	critical splice donor site	probably null
R1893:Aars2	UTSW	17	45514799	missense	probably benign	0.14
R2035:Aars2	UTSW	17	45514801	missense	possibly damaging	0.87
R2099:Aars2	UTSW	17	45506894	missense	unknown
R4342:Aars2	UTSW	17	45516495	missense	probably benign
R4600:Aars2	UTSW	17	45516921	missense	probably damaging	1.00
R4601:Aars2	UTSW	17	45516921	missense	probably damaging	1.00
R4610:Aars2	UTSW	17	45516921	missense	probably damaging	1.00
R5158:Aars2	UTSW	17	45514829	missense	probably benign	0.07
R5943:Aars2	UTSW	17	45517711	missense	probably benign	0.30
R5992:Aars2	UTSW	17	45508623	nonsense	probably null
R6255:Aars2	UTSW	17	45514609	missense	probably damaging	1.00
R6381:Aars2	UTSW	17	45518545	missense	probably benign	0.04
R6392:Aars2	UTSW	17	45514600	missense	probably damaging	0.98
R6406:Aars2	UTSW	17	45506939	missense	probably benign	0.16
R6648:Aars2	UTSW	17	45516564	missense	probably damaging	1.00
R7135:Aars2	UTSW	17	45508961	nonsense	probably null
R7197:Aars2	UTSW	17	45508959	missense	probably damaging	1.00
R7203:Aars2	UTSW	17	45516571	missense	probably damaging	1.00
R7289:Aars2	UTSW	17	45507624	missense	probably damaging	0.99
R7669:Aars2	UTSW	17	45520295	missense	probably benign	0.06
R8303:Aars2	UTSW	17	45507597	missense	probably damaging	1.00
R8772:Aars2	UTSW	17	45516977	missense	probably benign	0.19
R8795:Aars2	UTSW	17	45507672	missense	probably damaging	0.99
R9069:Aars2	UTSW	17	45507597	missense	probably damaging	1.00
R9206:Aars2	UTSW	17	45509404	missense	probably benign	0.03
R9342:Aars2	UTSW	17	45507076	missense	possibly damaging	0.94
R9467:Aars2	UTSW	17	45516484	missense	probably benign	0.01
R9730:Aars2	UTSW	17	45518608	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCAATGCAGGCATGAACCAGGTAG -3'
(R):5'- TCTTGGTCACAACATCCAGCACTC -3'

Sequencing Primer
(F):5'- ttgagtagacatttattgcactcc -3'
(R):5'- GCACTCAGGGTTCAAAGACTTTAAC -3'

Posted On

2013-07-11