Incidental Mutation 'R0629:Aars2'
ID 57784
Institutional Source Beutler Lab
Gene Symbol Aars2
Ensembl Gene ENSMUSG00000023938
Gene Name alanyl-tRNA synthetase 2, mitochondrial
Synonyms Aarsl
MMRRC Submission 038818-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0629 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 45817767-45831769 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 45818473 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 86 (D86V)
Ref Sequence ENSEMBL: ENSMUSP00000024733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024733]
AlphaFold Q14CH7
Predicted Effect probably damaging
Transcript: ENSMUST00000024733
AA Change: D86V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024733
Gene: ENSMUSG00000023938
AA Change: D86V

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:tRNA-synt_2c 36 619 4e-175 PFAM
low complexity region 663 674 N/A INTRINSIC
tRNA_SAD 716 774 2.65e-10 SMART
coiled coil region 833 863 N/A INTRINSIC
Meta Mutation Damage Score 0.6486 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class-II aminoacyl-tRNA synthetase family. Aminoacyl-tRNA synthetases play critical roles in mRNA translation by charging tRNAs with their cognate amino acids. The encoded protein is a mitochondrial enzyme that specifically aminoacylates alanyl-tRNA. Mutations in this gene are a cause of combined oxidative phosphorylation deficiency 8. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts14 G A 10: 61,047,403 (GRCm39) Q733* probably null Het
Adcy10 A G 1: 165,370,674 (GRCm39) D651G probably damaging Het
Apcdd1 T A 18: 63,067,041 (GRCm39) C52S probably damaging Het
Bclaf1 T C 10: 20,209,172 (GRCm39) S463P probably damaging Het
Cabcoco1 T C 10: 68,352,108 (GRCm39) Y68C probably damaging Het
Cacna1f G A X: 7,486,673 (GRCm39) S888N probably damaging Het
Cacna1g A G 11: 94,300,369 (GRCm39) C2134R possibly damaging Het
Cdc37 A C 9: 21,052,064 (GRCm39) M325R possibly damaging Het
Clca3a2 T A 3: 144,778,000 (GRCm39) M762L probably benign Het
Cntn3 C T 6: 102,180,937 (GRCm39) V753M probably damaging Het
Col6a6 A T 9: 105,604,364 (GRCm39) probably benign Het
Dscaml1 A G 9: 45,632,716 (GRCm39) D1194G probably damaging Het
Egfr G A 11: 16,819,333 (GRCm39) G288S probably damaging Het
Fbxl17 G T 17: 63,778,409 (GRCm39) N19K probably damaging Het
Fmo3 A G 1: 162,785,796 (GRCm39) probably benign Het
Frmd6 T C 12: 70,930,536 (GRCm39) Y219H probably damaging Het
Fuca1 T C 4: 135,652,955 (GRCm39) V193A possibly damaging Het
Gm7461 C T 8: 4,727,769 (GRCm39) noncoding transcript Het
Gpc5 T A 14: 115,789,651 (GRCm39) N508K possibly damaging Het
Iqch A T 9: 63,332,664 (GRCm39) D1019E probably benign Het
Isyna1 A G 8: 71,047,358 (GRCm39) Y27C probably damaging Het
Itgb8 T G 12: 119,166,216 (GRCm39) H105P probably benign Het
Kbtbd11 C T 8: 15,077,572 (GRCm39) P57L probably benign Het
Kcns3 A C 12: 11,142,559 (GRCm39) C47G probably damaging Het
Kif21b A T 1: 136,099,895 (GRCm39) probably null Het
Lama3 A T 18: 12,552,302 (GRCm39) H418L possibly damaging Het
Lrit3 A G 3: 129,581,951 (GRCm39) Y679H probably damaging Het
Lrrc19 T A 4: 94,526,489 (GRCm39) D356V probably damaging Het
Morc2b A G 17: 33,354,781 (GRCm39) M997T probably benign Het
Mroh9 T C 1: 162,888,205 (GRCm39) H290R possibly damaging Het
Mtcl1 A T 17: 66,645,137 (GRCm39) S1886T possibly damaging Het
Muc20 T C 16: 32,613,791 (GRCm39) T529A possibly damaging Het
Myo7a A C 7: 97,734,673 (GRCm39) L607R probably damaging Het
Myom2 T A 8: 15,119,783 (GRCm39) F180I probably damaging Het
Myt1l G A 12: 29,861,484 (GRCm39) E89K unknown Het
Nek2 A G 1: 191,563,429 (GRCm39) N431S probably benign Het
Oprm1 A T 10: 6,782,604 (GRCm39) probably null Het
Or2aj4 A T 16: 19,384,730 (GRCm39) V301E possibly damaging Het
Or5t7 T A 2: 86,506,873 (GRCm39) H268L possibly damaging Het
Oxsr1 A G 9: 119,070,850 (GRCm39) probably benign Het
Pasd1 G C X: 70,982,379 (GRCm39) R296P possibly damaging Het
Pdgfrb G A 18: 61,211,720 (GRCm39) probably null Het
Proser1 C A 3: 53,386,485 (GRCm39) P789Q probably benign Het
Ptgs2 A G 1: 149,976,788 (GRCm39) Q7R probably benign Het
Rab3d A G 9: 21,825,982 (GRCm39) V144A probably benign Het
Ralgapb T A 2: 158,281,467 (GRCm39) L167H probably damaging Het
Ranbp3 A G 17: 57,015,200 (GRCm39) T301A possibly damaging Het
Rasgrf1 G A 9: 89,866,322 (GRCm39) V587M probably damaging Het
Sec16b A G 1: 157,392,433 (GRCm39) probably benign Het
Sin3b T C 8: 73,480,164 (GRCm39) probably benign Het
Slc10a2 T C 8: 5,148,562 (GRCm39) S128G probably benign Het
Tbl1xr1 G A 3: 22,264,565 (GRCm39) V507I probably benign Het
Tmem8b T G 4: 43,669,896 (GRCm39) probably null Het
Trak1 A T 9: 121,196,233 (GRCm39) T22S probably benign Het
Trim30d A G 7: 104,136,862 (GRCm39) I114T probably damaging Het
Ttc13 A T 8: 125,401,105 (GRCm39) S624T probably damaging Het
Ttn T C 2: 76,658,474 (GRCm39) probably benign Het
Vipr1 T A 9: 121,489,237 (GRCm39) Y99* probably null Het
Vmn1r210 T C 13: 23,012,044 (GRCm39) K81E probably damaging Het
Wwc1 T C 11: 35,744,299 (GRCm39) Y841C probably benign Het
Xrcc4 A G 13: 90,149,024 (GRCm39) probably benign Het
Zdhhc22 A T 12: 87,035,071 (GRCm39) I127N probably damaging Het
Zdhhc7 A G 8: 120,814,785 (GRCm39) L8P possibly damaging Het
Zfp664 C A 5: 124,962,659 (GRCm39) L18I probably damaging Het
Other mutations in Aars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02958:Aars2 APN 17 45,829,098 (GRCm39) missense probably benign 0.00
dread_pirate UTSW 17 45,827,490 (GRCm39) missense probably damaging 1.00
R0266:Aars2 UTSW 17 45,818,436 (GRCm39) splice site probably benign
R0315:Aars2 UTSW 17 45,826,378 (GRCm39) missense possibly damaging 0.67
R0375:Aars2 UTSW 17 45,825,476 (GRCm39) missense probably damaging 0.99
R0981:Aars2 UTSW 17 45,831,257 (GRCm39) missense probably damaging 1.00
R1878:Aars2 UTSW 17 45,825,564 (GRCm39) critical splice donor site probably null
R1893:Aars2 UTSW 17 45,825,725 (GRCm39) missense probably benign 0.14
R2035:Aars2 UTSW 17 45,825,727 (GRCm39) missense possibly damaging 0.87
R2099:Aars2 UTSW 17 45,817,820 (GRCm39) missense unknown
R4342:Aars2 UTSW 17 45,827,421 (GRCm39) missense probably benign
R4600:Aars2 UTSW 17 45,827,847 (GRCm39) missense probably damaging 1.00
R4601:Aars2 UTSW 17 45,827,847 (GRCm39) missense probably damaging 1.00
R4610:Aars2 UTSW 17 45,827,847 (GRCm39) missense probably damaging 1.00
R5158:Aars2 UTSW 17 45,825,755 (GRCm39) missense probably benign 0.07
R5943:Aars2 UTSW 17 45,828,637 (GRCm39) missense probably benign 0.30
R5992:Aars2 UTSW 17 45,819,549 (GRCm39) nonsense probably null
R6255:Aars2 UTSW 17 45,825,535 (GRCm39) missense probably damaging 1.00
R6381:Aars2 UTSW 17 45,829,471 (GRCm39) missense probably benign 0.04
R6392:Aars2 UTSW 17 45,825,526 (GRCm39) missense probably damaging 0.98
R6406:Aars2 UTSW 17 45,817,865 (GRCm39) missense probably benign 0.16
R6648:Aars2 UTSW 17 45,827,490 (GRCm39) missense probably damaging 1.00
R7135:Aars2 UTSW 17 45,819,887 (GRCm39) nonsense probably null
R7197:Aars2 UTSW 17 45,819,885 (GRCm39) missense probably damaging 1.00
R7203:Aars2 UTSW 17 45,827,497 (GRCm39) missense probably damaging 1.00
R7289:Aars2 UTSW 17 45,818,550 (GRCm39) missense probably damaging 0.99
R7669:Aars2 UTSW 17 45,831,221 (GRCm39) missense probably benign 0.06
R8303:Aars2 UTSW 17 45,818,523 (GRCm39) missense probably damaging 1.00
R8772:Aars2 UTSW 17 45,827,903 (GRCm39) missense probably benign 0.19
R8795:Aars2 UTSW 17 45,818,598 (GRCm39) missense probably damaging 0.99
R9069:Aars2 UTSW 17 45,818,523 (GRCm39) missense probably damaging 1.00
R9206:Aars2 UTSW 17 45,820,330 (GRCm39) missense probably benign 0.03
R9342:Aars2 UTSW 17 45,818,002 (GRCm39) missense possibly damaging 0.94
R9467:Aars2 UTSW 17 45,827,410 (GRCm39) missense probably benign 0.01
R9730:Aars2 UTSW 17 45,829,534 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAATGCAGGCATGAACCAGGTAG -3'
(R):5'- TCTTGGTCACAACATCCAGCACTC -3'

Sequencing Primer
(F):5'- ttgagtagacatttattgcactcc -3'
(R):5'- GCACTCAGGGTTCAAAGACTTTAAC -3'
Posted On 2013-07-11