Incidental Mutation 'R7453:Fbn1'
ID577852
Institutional Source Beutler Lab
Gene Symbol Fbn1
Ensembl Gene ENSMUSG00000027204
Gene Namefibrillin 1
SynonymsFib-1
Accession Numbers

Genbank: NM_007993; MGI: 95489

Is this an essential gene? Probably essential (E-score: 0.886) question?
Stock #R7453 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location125300594-125507993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125320959 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 2136 (P2136S)
Ref Sequence ENSEMBL: ENSMUSP00000028633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028633] [ENSMUST00000103234]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028633
AA Change: P2136S

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028633
Gene: ENSMUSG00000027204
AA Change: P2136S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
EGF 118 146 8.52e0 SMART
EGF 149 178 5.4e-2 SMART
Pfam:TB 193 235 6.9e-17 PFAM
EGF_CA 246 287 3.56e-11 SMART
EGF_CA 288 329 9.39e-11 SMART
Pfam:TB 343 388 2.3e-17 PFAM
low complexity region 394 445 N/A INTRINSIC
EGF 454 491 8.57e-5 SMART
EGF_CA 492 531 9.39e-11 SMART
EGF_CA 532 573 2.38e-12 SMART
EGF_CA 574 614 5.48e-12 SMART
EGF_CA 615 655 5.39e-11 SMART
Pfam:TB 670 712 1.4e-17 PFAM
EGF_CA 725 766 1.53e-10 SMART
EGF_CA 767 808 2.42e-13 SMART
EGF_CA 809 848 2.44e-9 SMART
Pfam:TB 862 902 2.1e-14 PFAM
EGF_CA 912 953 3.32e-11 SMART
Pfam:TB 967 1009 3.9e-17 PFAM
EGF_CA 1030 1071 5.11e-12 SMART
EGF_CA 1072 1114 5.39e-11 SMART
EGF_CA 1115 1156 1.55e-11 SMART
EGF_CA 1157 1198 5.48e-12 SMART
EGF_CA 1199 1239 5.61e-9 SMART
EGF_CA 1240 1281 1.22e-9 SMART
EGF_CA 1282 1323 2.62e-9 SMART
EGF_CA 1324 1364 3.27e-10 SMART
EGF_CA 1365 1405 4.7e-11 SMART
EGF_CA 1406 1447 1.91e-11 SMART
EGF_CA 1448 1488 1.98e-9 SMART
EGF_CA 1489 1529 2.13e-9 SMART
Pfam:TB 1549 1590 3.5e-18 PFAM
EGF_CA 1608 1649 2.19e-11 SMART
EGF_CA 1650 1690 3.97e-9 SMART
Pfam:TB 1706 1749 9.7e-18 PFAM
EGF_CA 1768 1809 5.11e-12 SMART
EGF_CA 1810 1850 1.1e-11 SMART
EGF_CA 1851 1892 5.69e-10 SMART
EGF_CA 1893 1931 6.1e-10 SMART
EGF_CA 1932 1974 2.11e-13 SMART
EGF_CA 1975 2014 7.23e-12 SMART
EGF_CA 2015 2056 3.15e-12 SMART
Pfam:TB 2070 2112 3.7e-17 PFAM
EGF_CA 2129 2167 1.24e-10 SMART
EGF_CA 2168 2207 3.81e-11 SMART
EGF_CA 2208 2248 3.81e-11 SMART
EGF 2252 2292 5.24e0 SMART
EGF_CA 2293 2334 9.91e-10 SMART
Pfam:TB 2348 2391 8.5e-18 PFAM
EGF_CA 2404 2445 1.26e-11 SMART
EGF_CA 2446 2486 1.06e-9 SMART
EGF_CA 2487 2525 3.1e-11 SMART
EGF_CA 2526 2568 1.48e-8 SMART
EGF_CA 2569 2608 1.14e-9 SMART
EGF_CA 2609 2649 3.97e-9 SMART
EGF_CA 2650 2689 1.98e-9 SMART
low complexity region 2691 2698 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000103234
AA Change: P2136S

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099524
Gene: ENSMUSG00000027204
AA Change: P2136S

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
EGF 118 146 8.52e0 SMART
EGF 149 178 5.4e-2 SMART
Pfam:TB 194 232 3.5e-10 PFAM
EGF_CA 246 287 3.56e-11 SMART
EGF_CA 288 329 9.39e-11 SMART
Pfam:TB 344 388 6.8e-15 PFAM
low complexity region 394 445 N/A INTRINSIC
EGF 454 491 8.57e-5 SMART
EGF_CA 492 531 9.39e-11 SMART
EGF_CA 532 573 2.38e-12 SMART
EGF_CA 574 614 5.48e-12 SMART
EGF_CA 615 655 5.39e-11 SMART
Pfam:TB 671 712 8.3e-16 PFAM
EGF_CA 725 766 1.53e-10 SMART
EGF_CA 767 808 2.42e-13 SMART
EGF_CA 809 848 2.44e-9 SMART
Pfam:TB 863 898 3.1e-8 PFAM
EGF_CA 912 953 3.32e-11 SMART
Pfam:TB 968 1009 1.5e-15 PFAM
EGF_CA 1030 1071 5.11e-12 SMART
EGF_CA 1072 1114 5.39e-11 SMART
EGF_CA 1115 1156 1.55e-11 SMART
EGF_CA 1157 1198 5.48e-12 SMART
EGF_CA 1199 1239 5.61e-9 SMART
EGF_CA 1240 1281 1.22e-9 SMART
EGF_CA 1282 1323 2.62e-9 SMART
EGF_CA 1324 1364 3.27e-10 SMART
EGF_CA 1365 1405 4.7e-11 SMART
EGF_CA 1406 1447 1.91e-11 SMART
EGF_CA 1448 1488 1.98e-9 SMART
EGF_CA 1489 1529 2.13e-9 SMART
Pfam:TB 1550 1590 5.3e-17 PFAM
EGF_CA 1608 1649 2.19e-11 SMART
EGF_CA 1650 1690 3.97e-9 SMART
Pfam:TB 1707 1749 1.6e-16 PFAM
EGF_CA 1768 1809 5.11e-12 SMART
EGF_CA 1810 1850 1.1e-11 SMART
EGF_CA 1851 1892 5.69e-10 SMART
EGF_CA 1893 1931 6.1e-10 SMART
EGF_CA 1932 1974 2.11e-13 SMART
EGF_CA 1975 2014 7.23e-12 SMART
EGF_CA 2015 2056 3.15e-12 SMART
Pfam:TB 2071 2112 1.9e-15 PFAM
EGF_CA 2129 2167 1.24e-10 SMART
EGF_CA 2168 2207 3.81e-11 SMART
EGF_CA 2208 2248 3.81e-11 SMART
EGF 2252 2292 5.24e0 SMART
EGF_CA 2293 2334 9.91e-10 SMART
Pfam:TB 2349 2391 5.8e-15 PFAM
EGF_CA 2404 2445 1.26e-11 SMART
EGF_CA 2446 2486 1.06e-9 SMART
EGF_CA 2487 2525 3.1e-11 SMART
EGF_CA 2526 2568 1.48e-8 SMART
EGF_CA 2569 2608 1.14e-9 SMART
EGF_CA 2609 2649 3.97e-9 SMART
EGF_CA 2650 2689 1.98e-9 SMART
low complexity region 2691 2698 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype Strain: 1934905; 4880665
Lethality: D7-D10
FUNCTION: This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Homozygous knockout mice for this gene exhibit impaired aortic development and early postnatal death, which was attributed to a deficiency in the fibrillin-1 protein. Mice with a hypomorphic allele of this gene exhibit impaired glucose homeostasis, likely due to a reduction in serum asprosin levels. [provided by RefSeq, Apr 2016]
PHENOTYPE: Lethality among homozygotes for spontaneous and targeted mutations ranges from embryonic death to death around 4 months. Abnormalities include vascular defects, excess bone growth, connective tissue hyperplasia, and lung emphysema. Mice heterozygous for a knock-in allele exhibit scleroderma. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(9) Spontaneous(1)

Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A G 2: 156,003,389 S32P possibly damaging Het
Acaca T C 11: 84,245,310 V497A probably benign Het
Acox1 T C 11: 116,180,961 T214A probably benign Het
Adgrb2 G A 4: 130,014,637 probably null Het
Adh1 G A 3: 138,289,941 probably null Het
Angptl1 G T 1: 156,844,851 M82I probably benign Het
Arg1 A G 10: 24,915,776 L269P probably damaging Het
Arid2 T G 15: 96,370,724 V906G probably benign Het
Arid5b A T 10: 68,243,164 H114Q probably benign Het
Atad5 T C 11: 80,119,143 probably null Het
AU040320 G A 4: 126,835,700 probably null Het
B230104I21Rik A T 4: 154,347,728 T44S unknown Het
BC024063 G A 10: 82,110,157 R537H possibly damaging Het
Bfsp2 A T 9: 103,453,107 L177Q probably damaging Het
Birc5 C A 11: 117,852,681 H80Q probably damaging Het
Bpifb9a T C 2: 154,264,695 L382P probably damaging Het
Ces2c A T 8: 104,849,670 N105I probably benign Het
Cflar G A 1: 58,753,797 V441M Het
Ckap4 A G 10: 84,528,599 V200A probably damaging Het
Clec16a C A 16: 10,644,822 T668N probably damaging Het
Cntrl A C 2: 35,155,409 E1376D possibly damaging Het
Coq2 T C 5: 100,663,586 Y179C probably benign Het
Cpne6 A G 14: 55,512,016 E11G probably benign Het
Csf2rb2 C T 15: 78,285,291 D555N probably benign Het
Cyp2j12 A T 4: 96,102,126 V401D possibly damaging Het
Dbp C T 7: 45,705,703 A27V probably benign Het
Dll1 C A 17: 15,374,889 R42L probably benign Het
Dst C A 1: 34,191,358 H2677Q possibly damaging Het
Efl1 G T 7: 82,681,467 V283F possibly damaging Het
Enah C T 1: 181,961,905 C7Y unknown Het
Fam193a A T 5: 34,464,116 E1139V possibly damaging Het
Fggy T C 4: 95,597,690 V91A probably damaging Het
Fn1 T A 1: 71,590,880 D2343V probably damaging Het
Galk2 T C 2: 125,887,861 V54A possibly damaging Het
Glb1l T A 1: 75,202,706 Y193F probably damaging Het
Gm45861 G T 8: 27,541,658 R867L unknown Het
Grin2b T C 6: 135,740,949 D715G possibly damaging Het
Hltf A T 3: 20,082,752 R384S possibly damaging Het
Hs3st1 A G 5: 39,614,967 M111T probably damaging Het
Idua A G 5: 108,681,496 T388A probably benign Het
Kat14 T C 2: 144,380,734 S136P possibly damaging Het
Kif24 A C 4: 41,394,673 C867W possibly damaging Het
Klhdc10 T A 6: 30,447,990 probably null Het
Klra10 A G 6: 130,280,364 V59A probably damaging Het
Limk1 T A 5: 134,669,237 I223F probably damaging Het
Lrp10 G A 14: 54,468,456 G368S probably damaging Het
Lrrc7 T C 3: 158,185,409 R374G probably benign Het
Lypd1 T A 1: 125,873,566 M66L probably benign Het
Maats1 A G 16: 38,321,479 S364P possibly damaging Het
Mast4 C T 13: 102,804,641 probably null Het
Mbp C T 18: 82,554,643 H155Y probably damaging Het
Micu3 G A 8: 40,335,898 C150Y probably benign Het
Mras C T 9: 99,389,740 V174I probably benign Het
Mroh1 T A 15: 76,433,545 I827N probably damaging Het
Ms4a12 C A 19: 11,225,662 G101* probably null Het
Mylk2 A T 2: 152,912,433 K149M probably damaging Het
Myom3 T A 4: 135,801,035 L1064I probably damaging Het
Naa30 A G 14: 49,187,687 *365W probably null Het
Ncoa1 C T 12: 4,259,307 G1330R probably damaging Het
Nhlh1 T A 1: 172,054,279 T7S probably benign Het
Nipsnap3a A G 4: 52,995,882 Q110R probably benign Het
Nostrin T C 2: 69,183,896 Y399H possibly damaging Het
Nsfl1c C A 2: 151,509,511 T263K possibly damaging Het
Nup153 T C 13: 46,681,181 T1456A probably damaging Het
Olfr116 G T 17: 37,624,385 D83E probably benign Het
Olfr154 T A 2: 85,664,180 M85L probably benign Het
Olfr558 T A 7: 102,709,517 I86N probably damaging Het
Olfr67 T A 7: 103,787,672 I202F possibly damaging Het
Olfr933 A T 9: 38,976,204 H176L probably damaging Het
Olfr97 T C 17: 37,231,980 Y130C probably damaging Het
Pan3 G A 5: 147,526,681 probably null Het
Pcdhgb2 C T 18: 37,691,015 T353I probably damaging Het
Pcif1 A T 2: 164,888,364 H339L probably damaging Het
Pcif1 A G 2: 164,889,630 H501R possibly damaging Het
Pcnt T C 10: 76,389,450 H1740R probably benign Het
Polr1b T A 2: 129,125,663 I992N probably damaging Het
Ppfia2 C T 10: 106,927,830 T1228M possibly damaging Het
Ppp2r5e A G 12: 75,462,342 F388L probably damaging Het
Ptpre G T 7: 135,538,074 R4L unknown Het
Pzp G T 6: 128,486,916 P1410T probably damaging Het
Qrich1 A C 9: 108,556,476 K656T possibly damaging Het
Rabep1 C T 11: 70,917,660 P481S probably damaging Het
Rgs9 T A 11: 109,227,268 R579W probably damaging Het
Rhot1 T C 11: 80,248,540 probably null Het
Rreb1 T G 13: 37,941,569 C1284G probably damaging Het
Rsph4a A G 10: 33,909,293 E400G probably benign Het
S100pbp A G 4: 129,182,085 L149P probably damaging Het
Sall3 T C 18: 80,972,040 D891G probably benign Het
Scn10a C T 9: 119,638,552 V841I probably benign Het
Scn5a T A 9: 119,522,590 Y775F possibly damaging Het
Slc24a1 A T 9: 64,949,301 M108K unknown Het
Stk4 A G 2: 164,086,602 N118S probably benign Het
Stt3a A T 9: 36,747,970 S358T possibly damaging Het
Tbc1d31 T A 15: 57,950,995 F531I probably damaging Het
Tfrc A G 16: 32,619,049 T307A probably damaging Het
Thegl A G 5: 77,060,786 H387R probably damaging Het
Tnpo2 T C 8: 85,055,022 I811T probably damaging Het
Tnrc6b ACAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAG 15: 80,902,555 probably benign Het
Ttc23l T C 15: 10,533,767 Y230C probably damaging Het
Ttll13 A G 7: 80,260,434 D775G probably benign Het
Ttn T C 2: 76,944,929 K1969R unknown Het
Ube2s G A 7: 4,810,436 R110* probably null Het
Ubxn11 G A 4: 134,126,229 R364Q probably benign Het
Unc13d T C 11: 116,067,871 Q773R probably benign Het
Ush2a T C 1: 188,553,111 V1948A probably damaging Het
Vmn1r205 A T 13: 22,592,761 I57N probably damaging Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Vmn2r71 A T 7: 85,624,089 T704S probably benign Het
Vmn2r93 T A 17: 18,313,318 S495T probably benign Het
Zan A C 5: 137,466,002 L514V probably damaging Het
Zfp106 T A 2: 120,510,527 N1857I probably damaging Het
Zfp738 T C 13: 67,670,355 T506A probably benign Het
Zfp934 T C 13: 62,518,703 N53S probably benign Het
Other mutations in Fbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Fbn1 APN 2 125324947 missense probably damaging 1.00
IGL00159:Fbn1 APN 2 125397873 missense probably benign 0.14
IGL00500:Fbn1 APN 2 125317516 missense probably damaging 0.99
IGL00558:Fbn1 APN 2 125329128 splice site probably benign
IGL00645:Fbn1 APN 2 125317103 splice site probably benign
IGL00863:Fbn1 APN 2 125403219 missense possibly damaging 0.84
IGL00926:Fbn1 APN 2 125319042 missense possibly damaging 0.84
IGL00935:Fbn1 APN 2 125377910 nonsense probably null
IGL00950:Fbn1 APN 2 125358823 missense probably damaging 1.00
IGL01090:Fbn1 APN 2 125394776 splice site probably benign
IGL01106:Fbn1 APN 2 125351706 missense possibly damaging 0.55
IGL01486:Fbn1 APN 2 125389978 missense probably benign 0.03
IGL01519:Fbn1 APN 2 125317019 missense probably benign 0.07
IGL01585:Fbn1 APN 2 125360110 missense probably damaging 0.98
IGL01730:Fbn1 APN 2 125312974 splice site probably benign
IGL01793:Fbn1 APN 2 125387293 missense possibly damaging 0.67
IGL01803:Fbn1 APN 2 125350287 missense probably damaging 1.00
IGL01803:Fbn1 APN 2 125301725 missense probably benign
IGL01916:Fbn1 APN 2 125315446 missense possibly damaging 0.55
IGL02035:Fbn1 APN 2 125335362 splice site probably null
IGL02097:Fbn1 APN 2 125363969 missense probably damaging 1.00
IGL02233:Fbn1 APN 2 125321610 splice site probably benign
IGL02512:Fbn1 APN 2 125338460 missense probably damaging 1.00
IGL02552:Fbn1 APN 2 125412713 missense possibly damaging 0.86
IGL02657:Fbn1 APN 2 125352025 missense possibly damaging 0.86
IGL02718:Fbn1 APN 2 125369886 missense probably damaging 1.00
IGL02863:Fbn1 APN 2 125303256 missense possibly damaging 0.80
IGL02974:Fbn1 APN 2 125346330 missense probably null 0.99
IGL03058:Fbn1 APN 2 125403200 missense probably benign 0.03
IGL03172:Fbn1 APN 2 125320968 missense possibly damaging 0.92
IGL03288:Fbn1 APN 2 125303183 missense probably benign 0.13
Carinatum UTSW 2 125342830 missense possibly damaging 0.70
lincoln UTSW 2 125403170 missense possibly damaging 0.50
reaper UTSW 2 125315404 missense probably damaging 0.98
Scythe UTSW 2 125403228 missense possibly damaging 0.84
string_bean UTSW 2 125379134 splice site probably null
wirey UTSW 2 125309495 missense probably benign
3-1:Fbn1 UTSW 2 125394605 splice site probably benign
P0012:Fbn1 UTSW 2 125369321 splice site probably benign
PIT4403001:Fbn1 UTSW 2 125342911 missense probably damaging 1.00
PIT4466001:Fbn1 UTSW 2 125306501 missense possibly damaging 0.90
PIT4472001:Fbn1 UTSW 2 125306501 missense possibly damaging 0.90
PIT4651001:Fbn1 UTSW 2 125363989 critical splice acceptor site probably null
R0226:Fbn1 UTSW 2 125320910 missense possibly damaging 0.86
R0310:Fbn1 UTSW 2 125363644 missense probably damaging 1.00
R0362:Fbn1 UTSW 2 125309777 missense probably damaging 0.99
R0374:Fbn1 UTSW 2 125321676 missense possibly damaging 0.86
R0433:Fbn1 UTSW 2 125348215 missense possibly damaging 0.95
R0441:Fbn1 UTSW 2 125309755 critical splice donor site probably null
R0501:Fbn1 UTSW 2 125301749 missense probably benign 0.23
R0510:Fbn1 UTSW 2 125342925 splice site probably benign
R0573:Fbn1 UTSW 2 125389249 missense probably damaging 0.99
R0622:Fbn1 UTSW 2 125379024 missense possibly damaging 0.88
R0630:Fbn1 UTSW 2 125394770 missense possibly damaging 0.48
R0724:Fbn1 UTSW 2 125352064 missense probably benign 0.14
R0739:Fbn1 UTSW 2 125367630 missense probably benign 0.18
R0744:Fbn1 UTSW 2 125314814 splice site probably benign
R0811:Fbn1 UTSW 2 125403170 missense possibly damaging 0.50
R0812:Fbn1 UTSW 2 125403170 missense possibly damaging 0.50
R0862:Fbn1 UTSW 2 125342891 nonsense probably null
R0864:Fbn1 UTSW 2 125342891 nonsense probably null
R1061:Fbn1 UTSW 2 125345963 missense probably benign 0.01
R1126:Fbn1 UTSW 2 125321192 splice site probably null
R1172:Fbn1 UTSW 2 125394687 missense probably benign 0.13
R1175:Fbn1 UTSW 2 125394687 missense probably benign 0.13
R1183:Fbn1 UTSW 2 125321617 missense probably benign 0.07
R1218:Fbn1 UTSW 2 125412749 missense possibly damaging 0.71
R1241:Fbn1 UTSW 2 125372527 splice site probably benign
R1248:Fbn1 UTSW 2 125301609 missense probably benign 0.01
R1345:Fbn1 UTSW 2 125314671 missense probably damaging 1.00
R1374:Fbn1 UTSW 2 125346434 missense probably damaging 0.99
R1458:Fbn1 UTSW 2 125301929 missense probably benign 0.01
R1474:Fbn1 UTSW 2 125361265 missense possibly damaging 0.72
R1496:Fbn1 UTSW 2 125309495 missense probably benign
R1502:Fbn1 UTSW 2 125363706 nonsense probably null
R1511:Fbn1 UTSW 2 125306285 missense probably benign 0.00
R1588:Fbn1 UTSW 2 125319114 missense probably benign 0.19
R1626:Fbn1 UTSW 2 125341279 missense probably damaging 1.00
R1676:Fbn1 UTSW 2 125309781 missense probably damaging 1.00
R1712:Fbn1 UTSW 2 125346434 missense probably damaging 0.99
R1772:Fbn1 UTSW 2 125403228 missense possibly damaging 0.84
R1776:Fbn1 UTSW 2 125321734 missense possibly damaging 0.71
R1869:Fbn1 UTSW 2 125352027 missense probably benign 0.00
R1894:Fbn1 UTSW 2 125394621 missense probably damaging 0.96
R1925:Fbn1 UTSW 2 125363629 missense probably damaging 1.00
R1957:Fbn1 UTSW 2 125367654 missense possibly damaging 0.93
R1995:Fbn1 UTSW 2 125350373 critical splice acceptor site probably null
R2140:Fbn1 UTSW 2 125343810 missense probably damaging 1.00
R2142:Fbn1 UTSW 2 125412708 missense possibly damaging 0.93
R2268:Fbn1 UTSW 2 125321741 missense possibly damaging 0.49
R3409:Fbn1 UTSW 2 125412665 missense possibly damaging 0.92
R3418:Fbn1 UTSW 2 125320926 missense possibly damaging 0.55
R3508:Fbn1 UTSW 2 125306327 missense probably benign 0.19
R3778:Fbn1 UTSW 2 125317086 missense probably damaging 1.00
R3800:Fbn1 UTSW 2 125345974 missense possibly damaging 0.63
R4001:Fbn1 UTSW 2 125477495 critical splice donor site probably null
R4169:Fbn1 UTSW 2 125363952 missense possibly damaging 0.86
R4398:Fbn1 UTSW 2 125397781 missense probably benign 0.32
R4482:Fbn1 UTSW 2 125363610 critical splice donor site probably null
R4559:Fbn1 UTSW 2 125351714 missense possibly damaging 0.65
R4608:Fbn1 UTSW 2 125306500 missense probably benign 0.05
R4634:Fbn1 UTSW 2 125344061 missense probably damaging 1.00
R4706:Fbn1 UTSW 2 125370149 missense probably benign 0.21
R4712:Fbn1 UTSW 2 125341316 missense probably benign 0.12
R4783:Fbn1 UTSW 2 125324919 missense probably damaging 1.00
R4784:Fbn1 UTSW 2 125324919 missense probably damaging 1.00
R4785:Fbn1 UTSW 2 125324919 missense probably damaging 1.00
R4793:Fbn1 UTSW 2 125321235 nonsense probably null
R4838:Fbn1 UTSW 2 125372399 missense probably benign 0.01
R4864:Fbn1 UTSW 2 125372397 missense possibly damaging 0.92
R4887:Fbn1 UTSW 2 125309774 missense probably damaging 1.00
R4942:Fbn1 UTSW 2 125383616 missense possibly damaging 0.88
R4952:Fbn1 UTSW 2 125317534 missense probably damaging 1.00
R5030:Fbn1 UTSW 2 125412704 missense possibly damaging 0.51
R5044:Fbn1 UTSW 2 125329102 missense probably damaging 0.97
R5057:Fbn1 UTSW 2 125466695 missense probably benign 0.33
R5115:Fbn1 UTSW 2 125332383 missense probably damaging 1.00
R5399:Fbn1 UTSW 2 125332333 missense possibly damaging 0.69
R5498:Fbn1 UTSW 2 125360176 missense probably damaging 1.00
R5526:Fbn1 UTSW 2 125365639 missense possibly damaging 0.83
R5529:Fbn1 UTSW 2 125373950 missense probably benign 0.01
R5602:Fbn1 UTSW 2 125321741 missense possibly damaging 0.49
R5760:Fbn1 UTSW 2 125361247 missense probably damaging 1.00
R5837:Fbn1 UTSW 2 125379134 splice site probably null
R5955:Fbn1 UTSW 2 125358882 missense probably damaging 1.00
R5980:Fbn1 UTSW 2 125315404 missense probably damaging 0.98
R6039:Fbn1 UTSW 2 125363880 missense probably damaging 1.00
R6039:Fbn1 UTSW 2 125363880 missense probably damaging 1.00
R6058:Fbn1 UTSW 2 125466612 missense possibly damaging 0.73
R6089:Fbn1 UTSW 2 125321225 missense possibly damaging 0.55
R6136:Fbn1 UTSW 2 125403132 missense possibly damaging 0.63
R6161:Fbn1 UTSW 2 125369801 nonsense probably null
R6162:Fbn1 UTSW 2 125360227 missense probably damaging 1.00
R6165:Fbn1 UTSW 2 125332363 missense probably damaging 0.99
R6169:Fbn1 UTSW 2 125335489 critical splice acceptor site probably null
R6221:Fbn1 UTSW 2 125320921 missense probably benign 0.07
R6223:Fbn1 UTSW 2 125412671 missense possibly damaging 0.86
R6225:Fbn1 UTSW 2 125330543 missense probably damaging 1.00
R6238:Fbn1 UTSW 2 125324945 missense probably damaging 0.98
R6329:Fbn1 UTSW 2 125308473 missense possibly damaging 0.70
R6401:Fbn1 UTSW 2 125346450 missense probably damaging 0.98
R6480:Fbn1 UTSW 2 125335418 missense probably benign 0.05
R6513:Fbn1 UTSW 2 125383671 missense probably damaging 1.00
R6530:Fbn1 UTSW 2 125389270 missense probably damaging 0.99
R6595:Fbn1 UTSW 2 125342830 missense possibly damaging 0.70
R6781:Fbn1 UTSW 2 125317038 missense probably damaging 1.00
R6849:Fbn1 UTSW 2 125321691 missense possibly damaging 0.82
R6860:Fbn1 UTSW 2 125328158 missense probably damaging 1.00
R6960:Fbn1 UTSW 2 125382060 missense probably benign 0.16
R7134:Fbn1 UTSW 2 125382049 missense probably benign 0.03
R7241:Fbn1 UTSW 2 125306495 missense possibly damaging 0.86
R7295:Fbn1 UTSW 2 125335487 missense probably damaging 1.00
R7312:Fbn1 UTSW 2 125466674 missense possibly damaging 0.53
R7322:Fbn1 UTSW 2 125479195 missense possibly damaging 0.92
R7349:Fbn1 UTSW 2 125315401 missense possibly damaging 0.84
R7365:Fbn1 UTSW 2 125352049 missense probably damaging 0.97
R7392:Fbn1 UTSW 2 125343924 missense probably damaging 1.00
R7442:Fbn1 UTSW 2 125403212 missense possibly damaging 0.45
R7452:Fbn1 UTSW 2 125505455 missense possibly damaging 0.53
R7457:Fbn1 UTSW 2 125351747 missense possibly damaging 0.90
R7458:Fbn1 UTSW 2 125319116 missense probably benign 0.14
R7549:Fbn1 UTSW 2 125344027 missense probably damaging 0.99
R7570:Fbn1 UTSW 2 125397852 missense probably benign 0.29
R7666:Fbn1 UTSW 2 125306471 missense probably damaging 1.00
R7723:Fbn1 UTSW 2 125382034 nonsense probably null
X0019:Fbn1 UTSW 2 125383643 missense possibly damaging 0.82
X0020:Fbn1 UTSW 2 125369340 missense probably damaging 1.00
X0028:Fbn1 UTSW 2 125342798 critical splice donor site probably null
X0067:Fbn1 UTSW 2 125369914 missense possibly damaging 0.95
Z1088:Fbn1 UTSW 2 125350288 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGTTCAGTAAAAGCCAAATCGC -3'
(R):5'- CTGATGACTCAGCAGTTGGTG -3'

Sequencing Primer
(F):5'- AGCCAAATCGCTCAATTTTTGC -3'
(R):5'- TGAGTGCCCAGCTAGGTCTTC -3'
Posted On2019-10-07