Incidental Mutation 'R0629:Fbxl17'
ID57786
Institutional Source Beutler Lab
Gene Symbol Fbxl17
Ensembl Gene ENSMUSG00000023965
Gene NameF-box and leucine-rich repeat protein 17
Synonyms6330576B01Rik, Fbxo13, Fbx13, C130023C01Rik
MMRRC Submission 038818-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R0629 (G1)
Quality Score153
Status Validated
Chromosome17
Chromosomal Location63057452-63500017 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 63471414 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 19 (N19K)
Ref Sequence ENSEMBL: ENSMUSP00000108459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024761] [ENSMUST00000112840]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024761
AA Change: N500K

PolyPhen 2 Score 0.608 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024761
Gene: ENSMUSG00000023965
AA Change: N500K

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
low complexity region 76 89 N/A INTRINSIC
low complexity region 103 138 N/A INTRINSIC
low complexity region 180 193 N/A INTRINSIC
low complexity region 214 245 N/A INTRINSIC
low complexity region 246 270 N/A INTRINSIC
FBOX 324 365 3.1e-8 SMART
LRR 359 384 4.6e-1 SMART
LRR 385 410 2e-1 SMART
LRR 411 436 8.5e-2 SMART
LRR 437 462 6.9e-4 SMART
LRR 463 488 1.3e-5 SMART
LRR 489 514 5.2e-2 SMART
LRR 515 539 2.9e-3 SMART
LRR 540 564 2e-1 SMART
low complexity region 567 580 N/A INTRINSIC
LRR 591 615 8.4e-4 SMART
LRR 616 641 2.2e-1 SMART
LRR 642 667 6.3e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000090318
Predicted Effect probably damaging
Transcript: ENSMUST00000112840
AA Change: N19K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108459
Gene: ENSMUSG00000023965
AA Change: N19K

DomainStartEndE-ValueType
LRR 8 33 1.2e1 SMART
LRR 34 58 6.57e-1 SMART
LRR 59 83 4.67e1 SMART
low complexity region 86 99 N/A INTRINSIC
LRR 110 134 1.89e-1 SMART
LRR 135 160 5.25e1 SMART
LRR 161 186 1.47e2 SMART
Meta Mutation Damage Score 0.3611 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXL17, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1f G A X: 7,620,434 S888N probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Fbxl17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Fbxl17 APN 17 63385052 missense probably damaging 1.00
IGL02201:Fbxl17 APN 17 63499029 missense probably damaging 1.00
IGL02256:Fbxl17 APN 17 63499090 missense probably benign
IGL03408:Fbxl17 APN 17 63080546 nonsense probably null
R0268:Fbxl17 UTSW 17 63385067 splice site probably benign
R0269:Fbxl17 UTSW 17 63384992 missense probably damaging 0.99
R0313:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0315:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0344:Fbxl17 UTSW 17 63385067 splice site probably benign
R0356:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0358:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0553:Fbxl17 UTSW 17 63356851 missense probably damaging 1.00
R0617:Fbxl17 UTSW 17 63384992 missense probably damaging 0.99
R1597:Fbxl17 UTSW 17 63487818 missense probably damaging 1.00
R1666:Fbxl17 UTSW 17 63385065 splice site probably null
R3001:Fbxl17 UTSW 17 63225077 missense probably damaging 0.99
R3002:Fbxl17 UTSW 17 63225077 missense probably damaging 0.99
R3121:Fbxl17 UTSW 17 63471424 missense probably damaging 0.96
R3909:Fbxl17 UTSW 17 63499807 missense possibly damaging 0.93
R4789:Fbxl17 UTSW 17 63487915 missense probably benign 0.40
R6606:Fbxl17 UTSW 17 63487788 missense probably damaging 0.97
R7153:Fbxl17 UTSW 17 63060351 missense probably benign 0.09
R7722:Fbxl17 UTSW 17 63356828 missense probably damaging 0.99
X0019:Fbxl17 UTSW 17 63060383 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCATTCCTACAGGCACCACAGG -3'
(R):5'- AGAGGGCAGGTGGTTTCTAAAATGC -3'

Sequencing Primer
(F):5'- GAGTTAGATTCCCTGTCAGACAC -3'
(R):5'- GGCTTCTTTAAAATACTGCACGG -3'
Posted On2013-07-11