Incidental Mutation 'R7453:Thegl'
ID577878
Institutional Source Beutler Lab
Gene Symbol Thegl
Ensembl Gene ENSMUSG00000029248
Gene Nametheg spermatid protein like
Synonyms1700023E05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R7453 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location77016023-77061529 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77060786 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 387 (H387R)
Ref Sequence ENSEMBL: ENSMUSP00000031161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031161] [ENSMUST00000117880]
Predicted Effect probably damaging
Transcript: ENSMUST00000031161
AA Change: H387R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031161
Gene: ENSMUSG00000029248
AA Change: H387R

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117880
AA Change: H387R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112814
Gene: ENSMUSG00000029248
AA Change: H387R

DomainStartEndE-ValueType
low complexity region 21 30 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
THEG 172 190 4.56e2 SMART
THEG 212 231 5.84e0 SMART
THEG 258 277 3.1e-1 SMART
THEG 291 310 8.37e2 SMART
THEG 327 346 7.65e1 SMART
THEG 367 386 3.61e1 SMART
THEG 403 422 1.15e1 SMART
THEG 440 459 9.98e0 SMART
Meta Mutation Damage Score 0.2895 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (122/122)
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A G 2: 156,003,389 S32P possibly damaging Het
Acaca T C 11: 84,245,310 V497A probably benign Het
Acox1 T C 11: 116,180,961 T214A probably benign Het
Adgrb2 G A 4: 130,014,637 probably null Het
Adh1 G A 3: 138,289,941 probably null Het
Angptl1 G T 1: 156,844,851 M82I probably benign Het
Arg1 A G 10: 24,915,776 L269P probably damaging Het
Arid2 T G 15: 96,370,724 V906G probably benign Het
Arid5b A T 10: 68,243,164 H114Q probably benign Het
Atad5 T C 11: 80,119,143 probably null Het
AU040320 G A 4: 126,835,700 probably null Het
B230104I21Rik A T 4: 154,347,728 T44S unknown Het
BC024063 G A 10: 82,110,157 R537H possibly damaging Het
Bfsp2 A T 9: 103,453,107 L177Q probably damaging Het
Birc5 C A 11: 117,852,681 H80Q probably damaging Het
Bpifb9a T C 2: 154,264,695 L382P probably damaging Het
Ces2c A T 8: 104,849,670 N105I probably benign Het
Cflar G A 1: 58,753,797 V441M Het
Ckap4 A G 10: 84,528,599 V200A probably damaging Het
Clec16a C A 16: 10,644,822 T668N probably damaging Het
Cntrl A C 2: 35,155,409 E1376D possibly damaging Het
Col18a1 A T 10: 77,085,210 probably null Het
Coq2 T C 5: 100,663,586 Y179C probably benign Het
Cpne6 A G 14: 55,512,016 E11G probably benign Het
Cr2 A C 1: 195,165,257 probably null Het
Csf2rb2 C T 15: 78,285,291 D555N probably benign Het
Cyp2j12 A T 4: 96,102,126 V401D possibly damaging Het
Dbp C T 7: 45,705,703 A27V probably benign Het
Dll1 C A 17: 15,374,889 R42L probably benign Het
Dst C A 1: 34,191,358 H2677Q possibly damaging Het
Efl1 G T 7: 82,681,467 V283F possibly damaging Het
Enah C T 1: 181,961,905 C7Y unknown Het
Fam193a A T 5: 34,464,116 E1139V possibly damaging Het
Fbn1 G A 2: 125,320,959 P2136S possibly damaging Het
Fggy T C 4: 95,597,690 V91A probably damaging Het
Fn1 T A 1: 71,590,880 D2343V probably damaging Het
Galk2 T C 2: 125,887,861 V54A possibly damaging Het
Glb1l T A 1: 75,202,706 Y193F probably damaging Het
Gm45861 G T 8: 27,541,658 R867L unknown Het
Grin2b T C 6: 135,740,949 D715G possibly damaging Het
Hltf A T 3: 20,082,752 R384S possibly damaging Het
Hs3st1 A G 5: 39,614,967 M111T probably damaging Het
Idua A G 5: 108,681,496 T388A probably benign Het
Kat14 T C 2: 144,380,734 S136P possibly damaging Het
Kif24 A C 4: 41,394,673 C867W possibly damaging Het
Klhdc10 T A 6: 30,447,990 probably null Het
Klra10 A G 6: 130,280,364 V59A probably damaging Het
Limk1 T A 5: 134,669,237 I223F probably damaging Het
Lrp10 G A 14: 54,468,456 G368S probably damaging Het
Lrrc7 T C 3: 158,185,409 R374G probably benign Het
Lypd1 T A 1: 125,873,566 M66L probably benign Het
Maats1 A G 16: 38,321,479 S364P possibly damaging Het
Mast4 C T 13: 102,804,641 probably null Het
Mbp C T 18: 82,554,643 H155Y probably damaging Het
Micu3 G A 8: 40,335,898 C150Y probably benign Het
Mras C T 9: 99,389,740 V174I probably benign Het
Mroh1 T A 15: 76,433,545 I827N probably damaging Het
Ms4a12 C A 19: 11,225,662 G101* probably null Het
Mylk2 A T 2: 152,912,433 K149M probably damaging Het
Myom3 T A 4: 135,801,035 L1064I probably damaging Het
Naa30 A G 14: 49,187,687 *365W probably null Het
Ncoa1 C T 12: 4,259,307 G1330R probably damaging Het
Nhlh1 T A 1: 172,054,279 T7S probably benign Het
Nipsnap3a A G 4: 52,995,882 Q110R probably benign Het
Nostrin T C 2: 69,183,896 Y399H possibly damaging Het
Nsfl1c C A 2: 151,509,511 T263K possibly damaging Het
Nup153 T C 13: 46,681,181 T1456A probably damaging Het
Olfr116 G T 17: 37,624,385 D83E probably benign Het
Olfr154 T A 2: 85,664,180 M85L probably benign Het
Olfr558 T A 7: 102,709,517 I86N probably damaging Het
Olfr67 T A 7: 103,787,672 I202F possibly damaging Het
Olfr933 A T 9: 38,976,204 H176L probably damaging Het
Olfr97 T C 17: 37,231,980 Y130C probably damaging Het
Pan3 G A 5: 147,526,681 probably null Het
Pcdhgb2 C T 18: 37,691,015 T353I probably damaging Het
Pcif1 A T 2: 164,888,364 H339L probably damaging Het
Pcif1 A G 2: 164,889,630 H501R possibly damaging Het
Pcnt T C 10: 76,389,450 H1740R probably benign Het
Polr1b T A 2: 129,125,663 I992N probably damaging Het
Ppfia2 C T 10: 106,927,830 T1228M possibly damaging Het
Ppp2r5e A G 12: 75,462,342 F388L probably damaging Het
Ptpre G T 7: 135,538,074 R4L unknown Het
Pzp G T 6: 128,486,916 P1410T probably damaging Het
Qrich1 A C 9: 108,556,476 K656T possibly damaging Het
Rabep1 C T 11: 70,917,660 P481S probably damaging Het
Rgs9 T A 11: 109,227,268 R579W probably damaging Het
Rhot1 T C 11: 80,248,540 probably null Het
Rnf123 T A 9: 108,070,408 probably null Het
Rreb1 T G 13: 37,941,569 C1284G probably damaging Het
Rsph4a A G 10: 33,909,293 E400G probably benign Het
Rufy4 T A 1: 74,129,334 probably null Het
S100pbp A G 4: 129,182,085 L149P probably damaging Het
Sall3 T C 18: 80,972,040 D891G probably benign Het
Scn10a C T 9: 119,638,552 V841I probably benign Het
Scn5a T A 9: 119,522,590 Y775F possibly damaging Het
Sec62 A T 3: 30,809,796 probably null Het
Slc24a1 A T 9: 64,949,301 M108K unknown Het
Spata22 T A 11: 73,335,990 probably null Het
Stk4 A G 2: 164,086,602 N118S probably benign Het
Stt3a A T 9: 36,747,970 S358T possibly damaging Het
Tbc1d31 T A 15: 57,950,995 F531I probably damaging Het
Tfrc A G 16: 32,619,049 T307A probably damaging Het
Tnpo2 T C 8: 85,055,022 I811T probably damaging Het
Ttc23l T C 15: 10,533,767 Y230C probably damaging Het
Ttll13 A G 7: 80,260,434 D775G probably benign Het
Ttn T C 2: 76,944,929 K1969R unknown Het
Ube2s G A 7: 4,810,436 R110* probably null Het
Ubxn11 G A 4: 134,126,229 R364Q probably benign Het
Unc13d T C 11: 116,067,871 Q773R probably benign Het
Ush2a T C 1: 188,553,111 V1948A probably damaging Het
Vmn1r205 A T 13: 22,592,761 I57N probably damaging Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Vmn2r71 A T 7: 85,624,089 T704S probably benign Het
Vmn2r93 T A 17: 18,313,318 S495T probably benign Het
Wiz T A 17: 32,379,075 I102F probably benign Het
Zan A C 5: 137,466,002 L514V probably damaging Het
Zfp106 T A 2: 120,510,527 N1857I probably damaging Het
Zfp106 A T 2: 120,545,919 probably null Het
Zfp738 T C 13: 67,670,355 T506A probably benign Het
Zfp934 T C 13: 62,518,703 N53S probably benign Het
Other mutations in Thegl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Thegl APN 5 77060831 missense probably damaging 1.00
IGL02008:Thegl APN 5 77060758 missense probably benign 0.01
IGL02014:Thegl APN 5 77047155 missense probably damaging 0.99
IGL02525:Thegl APN 5 77016553 missense probably benign 0.08
IGL03036:Thegl APN 5 77016350 missense possibly damaging 0.86
IGL03200:Thegl APN 5 77060864 missense possibly damaging 0.66
IGL03302:Thegl APN 5 77054576 missense probably benign 0.09
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0242:Thegl UTSW 5 77016305 nonsense probably null
R0483:Thegl UTSW 5 77037357 splice site probably benign
R1875:Thegl UTSW 5 77054584 missense probably benign 0.29
R2121:Thegl UTSW 5 77060758 missense probably benign 0.01
R2232:Thegl UTSW 5 77059405 missense possibly damaging 0.84
R2280:Thegl UTSW 5 77059367 missense probably damaging 1.00
R2281:Thegl UTSW 5 77059367 missense probably damaging 1.00
R4422:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4423:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4424:Thegl UTSW 5 77054536 missense possibly damaging 0.91
R4935:Thegl UTSW 5 77037353 critical splice donor site probably null
R5041:Thegl UTSW 5 77056081 missense probably benign 0.05
R5175:Thegl UTSW 5 77016470 missense probably benign 0.00
R5560:Thegl UTSW 5 77016486 missense possibly damaging 0.61
R6086:Thegl UTSW 5 77061305 missense probably benign 0.11
R6193:Thegl UTSW 5 77016336 missense possibly damaging 0.85
R7070:Thegl UTSW 5 77047277 critical splice donor site probably null
R7703:Thegl UTSW 5 77016597 missense probably benign 0.34
RF007:Thegl UTSW 5 77016408 small insertion probably benign
RF010:Thegl UTSW 5 77016427 small insertion probably benign
RF014:Thegl UTSW 5 77016400 small insertion probably benign
RF016:Thegl UTSW 5 77016408 small insertion probably benign
RF020:Thegl UTSW 5 77016400 small insertion probably benign
RF028:Thegl UTSW 5 77016401 small insertion probably benign
RF030:Thegl UTSW 5 77016401 small insertion probably benign
RF031:Thegl UTSW 5 77016410 small insertion probably benign
RF033:Thegl UTSW 5 77016405 small insertion probably benign
RF033:Thegl UTSW 5 77016429 small insertion probably benign
RF036:Thegl UTSW 5 77016429 small insertion probably benign
RF037:Thegl UTSW 5 77016421 small insertion probably benign
RF039:Thegl UTSW 5 77016402 small insertion probably benign
RF044:Thegl UTSW 5 77016405 small insertion probably benign
RF046:Thegl UTSW 5 77016403 small insertion probably benign
RF055:Thegl UTSW 5 77016403 small insertion probably benign
RF060:Thegl UTSW 5 77016427 small insertion probably benign
RF063:Thegl UTSW 5 77016426 small insertion probably benign
RF064:Thegl UTSW 5 77016415 small insertion probably benign
Z1176:Thegl UTSW 5 77060794 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGACTGCTCCACCTAAGAG -3'
(R):5'- GTTGTCATGTTCCAAAGGATTTGC -3'

Sequencing Primer
(F):5'- TCCACCTAAGAGCAGAGGC -3'
(R):5'- AATGAGTCGCAGCGTAAG -3'
Posted On2019-10-07