Mutagenetix > Incidental Mutation

Incidental Mutation 'R7453:Grin2b'

577887

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7453 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135740949 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 715 (D715G)

Ref Sequence

ENSEMBL: ENSMUSP00000062284 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053880
AA Change: D715G

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: D715G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000111905
AA Change: D715G

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: D715G

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (122/122)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 120 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6430550D23Rik	A	G	2: 156,003,389	S32P	possibly damaging	Het
Acaca	T	C	11: 84,245,310	V497A	probably benign	Het
Acox1	T	C	11: 116,180,961	T214A	probably benign	Het
Adgrb2	G	A	4: 130,014,637		probably null	Het
Adh1	G	A	3: 138,289,941		probably null	Het
Angptl1	G	T	1: 156,844,851	M82I	probably benign	Het
Arg1	A	G	10: 24,915,776	L269P	probably damaging	Het
Arid2	T	G	15: 96,370,724	V906G	probably benign	Het
Arid5b	A	T	10: 68,243,164	H114Q	probably benign	Het
Atad5	T	C	11: 80,119,143		probably null	Het
AU040320	G	A	4: 126,835,700		probably null	Het
B230104I21Rik	A	T	4: 154,347,728	T44S	unknown	Het
BC024063	G	A	10: 82,110,157	R537H	possibly damaging	Het
Bfsp2	A	T	9: 103,453,107	L177Q	probably damaging	Het
Birc5	C	A	11: 117,852,681	H80Q	probably damaging	Het
Bpifb9a	T	C	2: 154,264,695	L382P	probably damaging	Het
Ces2c	A	T	8: 104,849,670	N105I	probably benign	Het
Cflar	G	A	1: 58,753,797	V441M		Het
Ckap4	A	G	10: 84,528,599	V200A	probably damaging	Het
Clec16a	C	A	16: 10,644,822	T668N	probably damaging	Het
Cntrl	A	C	2: 35,155,409	E1376D	possibly damaging	Het
Col18a1	A	T	10: 77,085,210		probably null	Het
Coq2	T	C	5: 100,663,586	Y179C	probably benign	Het
Cpne6	A	G	14: 55,512,016	E11G	probably benign	Het
Cr2	A	C	1: 195,165,257		probably null	Het
Csf2rb2	C	T	15: 78,285,291	D555N	probably benign	Het
Cyp2j12	A	T	4: 96,102,126	V401D	possibly damaging	Het
Dbp	C	T	7: 45,705,703	A27V	probably benign	Het
Dll1	C	A	17: 15,374,889	R42L	probably benign	Het
Dst	C	A	1: 34,191,358	H2677Q	possibly damaging	Het
Efl1	G	T	7: 82,681,467	V283F	possibly damaging	Het
Enah	C	T	1: 181,961,905	C7Y	unknown	Het
Fam193a	A	T	5: 34,464,116	E1139V	possibly damaging	Het
Fbn1	G	A	2: 125,320,959	P2136S	possibly damaging	Het
Fggy	T	C	4: 95,597,690	V91A	probably damaging	Het
Fn1	T	A	1: 71,590,880	D2343V	probably damaging	Het
Galk2	T	C	2: 125,887,861	V54A	possibly damaging	Het
Glb1l	T	A	1: 75,202,706	Y193F	probably damaging	Het
Gm45861	G	T	8: 27,541,658	R867L	unknown	Het
Hltf	A	T	3: 20,082,752	R384S	possibly damaging	Het
Hs3st1	A	G	5: 39,614,967	M111T	probably damaging	Het
Idua	A	G	5: 108,681,496	T388A	probably benign	Het
Kat14	T	C	2: 144,380,734	S136P	possibly damaging	Het
Kif24	A	C	4: 41,394,673	C867W	possibly damaging	Het
Klhdc10	T	A	6: 30,447,990		probably null	Het
Klra10	A	G	6: 130,280,364	V59A	probably damaging	Het
Limk1	T	A	5: 134,669,237	I223F	probably damaging	Het
Lrp10	G	A	14: 54,468,456	G368S	probably damaging	Het
Lrrc7	T	C	3: 158,185,409	R374G	probably benign	Het
Lypd1	T	A	1: 125,873,566	M66L	probably benign	Het
Maats1	A	G	16: 38,321,479	S364P	possibly damaging	Het
Mast4	C	T	13: 102,804,641		probably null	Het
Mbp	C	T	18: 82,554,643	H155Y	probably damaging	Het
Micu3	G	A	8: 40,335,898	C150Y	probably benign	Het
Mras	C	T	9: 99,389,740	V174I	probably benign	Het
Mroh1	T	A	15: 76,433,545	I827N	probably damaging	Het
Ms4a12	C	A	19: 11,225,662	G101*	probably null	Het
Mylk2	A	T	2: 152,912,433	K149M	probably damaging	Het
Myom3	T	A	4: 135,801,035	L1064I	probably damaging	Het
Naa30	A	G	14: 49,187,687	*365W	probably null	Het
Ncoa1	C	T	12: 4,259,307	G1330R	probably damaging	Het
Nhlh1	T	A	1: 172,054,279	T7S	probably benign	Het
Nipsnap3a	A	G	4: 52,995,882	Q110R	probably benign	Het
Nostrin	T	C	2: 69,183,896	Y399H	possibly damaging	Het
Nsfl1c	C	A	2: 151,509,511	T263K	possibly damaging	Het
Nup153	T	C	13: 46,681,181	T1456A	probably damaging	Het
Olfr116	G	T	17: 37,624,385	D83E	probably benign	Het
Olfr154	T	A	2: 85,664,180	M85L	probably benign	Het
Olfr558	T	A	7: 102,709,517	I86N	probably damaging	Het
Olfr67	T	A	7: 103,787,672	I202F	possibly damaging	Het
Olfr933	A	T	9: 38,976,204	H176L	probably damaging	Het
Olfr97	T	C	17: 37,231,980	Y130C	probably damaging	Het
Pan3	G	A	5: 147,526,681		probably null	Het
Pcdhgb2	C	T	18: 37,691,015	T353I	probably damaging	Het
Pcif1	A	T	2: 164,888,364	H339L	probably damaging	Het
Pcif1	A	G	2: 164,889,630	H501R	possibly damaging	Het
Pcnt	T	C	10: 76,389,450	H1740R	probably benign	Het
Polr1b	T	A	2: 129,125,663	I992N	probably damaging	Het
Ppfia2	C	T	10: 106,927,830	T1228M	possibly damaging	Het
Ppp2r5e	A	G	12: 75,462,342	F388L	probably damaging	Het
Ptpre	G	T	7: 135,538,074	R4L	unknown	Het
Pzp	G	T	6: 128,486,916	P1410T	probably damaging	Het
Qrich1	A	C	9: 108,556,476	K656T	possibly damaging	Het
Rabep1	C	T	11: 70,917,660	P481S	probably damaging	Het
Rgs9	T	A	11: 109,227,268	R579W	probably damaging	Het
Rhot1	T	C	11: 80,248,540		probably null	Het
Rnf123	T	A	9: 108,070,408		probably null	Het
Rreb1	T	G	13: 37,941,569	C1284G	probably damaging	Het
Rsph4a	A	G	10: 33,909,293	E400G	probably benign	Het
Rufy4	T	A	1: 74,129,334		probably null	Het
S100pbp	A	G	4: 129,182,085	L149P	probably damaging	Het
Sall3	T	C	18: 80,972,040	D891G	probably benign	Het
Scn10a	C	T	9: 119,638,552	V841I	probably benign	Het
Scn5a	T	A	9: 119,522,590	Y775F	possibly damaging	Het
Sec62	A	T	3: 30,809,796		probably null	Het
Slc24a1	A	T	9: 64,949,301	M108K	unknown	Het
Spata22	T	A	11: 73,335,990		probably null	Het
Stk4	A	G	2: 164,086,602	N118S	probably benign	Het
Stt3a	A	T	9: 36,747,970	S358T	possibly damaging	Het
Tbc1d31	T	A	15: 57,950,995	F531I	probably damaging	Het
Tfrc	A	G	16: 32,619,049	T307A	probably damaging	Het
Thegl	A	G	5: 77,060,786	H387R	probably damaging	Het
Tnpo2	T	C	8: 85,055,022	I811T	probably damaging	Het
Ttc23l	T	C	15: 10,533,767	Y230C	probably damaging	Het
Ttll13	A	G	7: 80,260,434	D775G	probably benign	Het
Ttn	T	C	2: 76,944,929	K1969R	unknown	Het
Ube2s	G	A	7: 4,810,436	R110*	probably null	Het
Ubxn11	G	A	4: 134,126,229	R364Q	probably benign	Het
Unc13d	T	C	11: 116,067,871	Q773R	probably benign	Het
Ush2a	T	C	1: 188,553,111	V1948A	probably damaging	Het
Vmn1r205	A	T	13: 22,592,761	I57N	probably damaging	Het
Vmn2r69	GAAAA	GAAAAA	7: 85,411,560		probably null	Het
Vmn2r71	A	T	7: 85,624,089	T704S	probably benign	Het
Vmn2r93	T	A	17: 18,313,318	S495T	probably benign	Het
Wiz	T	A	17: 32,379,075	I102F	probably benign	Het
Zan	A	C	5: 137,466,002	L514V	probably damaging	Het
Zfp106	T	A	2: 120,510,527	N1857I	probably damaging	Het
Zfp106	A	T	2: 120,545,919		probably null	Het
Zfp738	T	C	13: 67,670,355	T506A	probably benign	Het
Zfp934	T	C	13: 62,518,703	N53S	probably benign	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135733929	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135732732	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135778700	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135733429	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3418:Grin2b	UTSW	6	135843110	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135778699	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135733407	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135733944	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6612:Grin2b	UTSW	6	135740998	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135732551	missense	probably benign
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135780306	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135780251	missense	probably damaging	0.97
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135923364	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135733488	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135732499	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135923076	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135922969	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135733916	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135922987	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136044009	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135732511	frame shift	probably null
R9076:Grin2b	UTSW	6	135732511	frame shift	probably null
R9172:Grin2b	UTSW	6	135779257	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135733401	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135922870	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCCCACATTCATGCAAGCAG -3'
(R):5'- CTCACTAATGCTGACTTAATGTCTC -3'

Sequencing Primer
(F):5'- CAATTTGCAGGATGGTATATAGAAGC -3'
(R):5'- AATGCTGACTTAATGTCTCTTCAC -3'

Posted On

2019-10-07