Mutagenetix > Incidental Mutation

Incidental Mutation 'R0629:Pdgfrb'

57789

Institutional Source

Beutler Lab

Gene Symbol

Pdgfrb

Ensembl Gene

ENSMUSG00000024620

Gene Name

platelet derived growth factor receptor, beta polypeptide

Synonyms

CD140b, Pdgfr

MMRRC Submission

038818-MU

Accession Numbers

Ncbi RefSeq: NM_001146268.1, NM_008809.2; MGI:97531

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0629 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

61045150-61085061 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 61078648 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000110929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025522] [ENSMUST00000115274]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000025522

SMART Domains

Protein: ENSMUSP00000025522
Gene: ENSMUSG00000024620

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
IG	38	120	5.58e-2	SMART
IGc2	225	297	2.83e-12	SMART
IG_like	330	402	1.47e0	SMART
Pfam:Ig_2	415	524	5.6e-2	PFAM
transmembrane domain	534	556	N/A	INTRINSIC
TyrKc	600	958	1.11e-135	SMART
low complexity region	1063	1083	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115274

SMART Domains

Protein: ENSMUSP00000110929
Gene: ENSMUSG00000024620

Domain	Start	End	E-Value	Type
low complexity region	14	28	N/A	INTRINSIC
IG	42	124	5.58e-2	SMART
IGc2	229	301	2.83e-12	SMART
IG_like	334	406	1.47e0	SMART
transmembrane domain	538	560	N/A	INTRINSIC
TyrKc	604	962	1.11e-135	SMART
low complexity region	1067	1087	N/A	INTRINSIC

Meta Mutation Damage Score

0.9491

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

100% (66/66)

MGI Phenotype

Strain: 2682393; 2135508
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. These growth factors are mitogens for cells of mesenchymal origin. The identity of the growth factor bound to a receptor monomer determines whether the functional receptor is a homodimer or a heterodimer, composed of both platelet-derived growth factor receptor alpha and beta polypeptides. This gene is flanked on chromosome 5 by the genes for granulocyte-macrophage colony-stimulating factor and macrophage-colony stimulating factor receptor; all three genes may be implicated in the 5-q syndrome. A translocation between chromosomes 5 and 12, that fuses this gene to that of the translocation, ETV6, leukemia gene, results in chronic myeloproliferative disorder with eosinophilia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die perinatally with internal bleeding, thrombocytopenia, anemia and kidney defects. A frameshift mutation results in neonatal lethals with edema and hemorrhaging; several point mutations show cardiovascular abnormalities. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(23) Gene trapped(2)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aars2	A	T	17: 45,507,547	D86V	probably damaging	Het
Adamts14	G	A	10: 61,211,624	Q733*	probably null	Het
Adcy10	A	G	1: 165,543,105	D651G	probably damaging	Het
Apcdd1	T	A	18: 62,933,970	C52S	probably damaging	Het
Bclaf1	T	C	10: 20,333,426	S463P	probably damaging	Het
Cabcoco1	T	C	10: 68,516,278	Y68C	probably damaging	Het
Cacna1f	G	A	X: 7,620,434	S888N	probably damaging	Het
Cacna1g	A	G	11: 94,409,543	C2134R	possibly damaging	Het
Cdc37	A	C	9: 21,140,768	M325R	possibly damaging	Het
Clca2	T	A	3: 145,072,239	M762L	probably benign	Het
Cntn3	C	T	6: 102,203,976	V753M	probably damaging	Het
Col6a6	A	T	9: 105,727,165		probably benign	Het
Dscaml1	A	G	9: 45,721,418	D1194G	probably damaging	Het
Egfr	G	A	11: 16,869,333	G288S	probably damaging	Het
Fbxl17	G	T	17: 63,471,414	N19K	probably damaging	Het
Fmo3	A	G	1: 162,958,227		probably benign	Het
Frmd6	T	C	12: 70,883,762	Y219H	probably damaging	Het
Fuca1	T	C	4: 135,925,644	V193A	possibly damaging	Het
Gm1141	G	C	X: 71,938,773	R296P	possibly damaging	Het
Gm7461	C	T	8: 4,677,769		noncoding transcript	Het
Gpc5	T	A	14: 115,552,239	N508K	possibly damaging	Het
Iqch	A	T	9: 63,425,382	D1019E	probably benign	Het
Isyna1	A	G	8: 70,594,708	Y27C	probably damaging	Het
Itgb8	T	G	12: 119,202,481	H105P	probably benign	Het
Kbtbd11	C	T	8: 15,027,572	P57L	probably benign	Het
Kcns3	A	C	12: 11,092,558	C47G	probably damaging	Het
Kif21b	A	T	1: 136,172,157		probably null	Het
Lama3	A	T	18: 12,419,245	H418L	possibly damaging	Het
Lrit3	A	G	3: 129,788,302	Y679H	probably damaging	Het
Lrrc19	T	A	4: 94,638,252	D356V	probably damaging	Het
Morc2b	A	G	17: 33,135,807	M997T	probably benign	Het
Mroh9	T	C	1: 163,060,636	H290R	possibly damaging	Het
Mtcl1	A	T	17: 66,338,142	S1886T	possibly damaging	Het
Muc20	T	C	16: 32,793,421	T529A	possibly damaging	Het
Myo7a	A	C	7: 98,085,466	L607R	probably damaging	Het
Myom2	T	A	8: 15,069,783	F180I	probably damaging	Het
Myt1l	G	A	12: 29,811,485	E89K	unknown	Het
Nek2	A	G	1: 191,831,317	N431S	probably benign	Het
Olfr1086	T	A	2: 86,676,529	H268L	possibly damaging	Het
Olfr169	A	T	16: 19,565,980	V301E	possibly damaging	Het
Oprm1	A	T	10: 6,832,604		probably null	Het
Oxsr1	A	G	9: 119,241,784		probably benign	Het
Proser1	C	A	3: 53,479,064	P789Q	probably benign	Het
Ptgs2	A	G	1: 150,101,037	Q7R	probably benign	Het
Rab3d	A	G	9: 21,914,686	V144A	probably benign	Het
Ralgapb	T	A	2: 158,439,547	L167H	probably damaging	Het
Ranbp3	A	G	17: 56,708,200	T301A	possibly damaging	Het
Rasgrf1	G	A	9: 89,984,269	V587M	probably damaging	Het
Sec16b	A	G	1: 157,564,863		probably benign	Het
Sin3b	T	C	8: 72,753,536		probably benign	Het
Slc10a2	T	C	8: 5,098,562	S128G	probably benign	Het
Tbl1xr1	G	A	3: 22,210,401	V507I	probably benign	Het
Tmem8b	T	G	4: 43,669,896		probably null	Het
Trak1	A	T	9: 121,367,167	T22S	probably benign	Het
Trim30d	A	G	7: 104,487,655	I114T	probably damaging	Het
Ttc13	A	T	8: 124,674,366	S624T	probably damaging	Het
Ttn	T	C	2: 76,828,130		probably benign	Het
Vipr1	T	A	9: 121,660,171	Y99*	probably null	Het
Vmn1r210	T	C	13: 22,827,874	K81E	probably damaging	Het
Wwc1	T	C	11: 35,853,472	Y841C	probably benign	Het
Xrcc4	A	G	13: 90,000,905		probably benign	Het
Zdhhc22	A	T	12: 86,988,297	I127N	probably damaging	Het
Zdhhc7	A	G	8: 120,088,046	L8P	possibly damaging	Het
Zfp664	C	A	5: 124,885,595	L18I	probably damaging	Het

Other mutations in Pdgfrb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Pdgfrb	APN	18	61068936	missense	probably benign	0.20
IGL01396:Pdgfrb	APN	18	61072664	missense	probably damaging	1.00
IGL02377:Pdgfrb	APN	18	61080332	missense	probably damaging	1.00
IGL02435:Pdgfrb	APN	18	61064926	critical splice donor site	probably null
IGL03397:Pdgfrb	APN	18	61079681	missense	probably benign	0.28
R0021:Pdgfrb	UTSW	18	61064926	critical splice donor site	probably benign
R0021:Pdgfrb	UTSW	18	61064926	critical splice donor site	probably benign
R0087:Pdgfrb	UTSW	18	61061513	missense	probably damaging	1.00
R0119:Pdgfrb	UTSW	18	61068852	missense	probably benign	0.06
R0299:Pdgfrb	UTSW	18	61068852	missense	probably benign	0.06
R0532:Pdgfrb	UTSW	18	61083265	missense	probably damaging	1.00
R0570:Pdgfrb	UTSW	18	61077703	missense	probably benign	0.00
R0650:Pdgfrb	UTSW	18	61079708	missense	probably benign	0.00
R0853:Pdgfrb	UTSW	18	61080327	missense	probably damaging	1.00
R1165:Pdgfrb	UTSW	18	61064002	missense	probably benign	0.01
R1342:Pdgfrb	UTSW	18	61065880	nonsense	probably null
R1740:Pdgfrb	UTSW	18	61081833	missense	possibly damaging	0.93
R1808:Pdgfrb	UTSW	18	61068102	missense	probably benign
R1864:Pdgfrb	UTSW	18	61071717	missense	probably benign	0.00
R1960:Pdgfrb	UTSW	18	61065783	missense	probably benign	0.05
R1961:Pdgfrb	UTSW	18	61061505	missense	possibly damaging	0.49
R1970:Pdgfrb	UTSW	18	61066494	splice site	probably benign
R2011:Pdgfrb	UTSW	18	61061494	missense	probably benign	0.01
R2012:Pdgfrb	UTSW	18	61061494	missense	probably benign	0.01
R2018:Pdgfrb	UTSW	18	61083334	missense	possibly damaging	0.84
R2153:Pdgfrb	UTSW	18	61072756	missense	probably damaging	1.00
R2497:Pdgfrb	UTSW	18	61078628	missense	possibly damaging	0.58
R2846:Pdgfrb	UTSW	18	61064016	missense	probably benign	0.00
R3776:Pdgfrb	UTSW	18	61081920	missense	probably benign	0.00
R3779:Pdgfrb	UTSW	18	61072666	missense	probably damaging	1.00
R3816:Pdgfrb	UTSW	18	61078945	missense	probably damaging	1.00
R3978:Pdgfrb	UTSW	18	61073685	missense	probably damaging	1.00
R4259:Pdgfrb	UTSW	18	61077631	missense	probably benign	0.00
R4261:Pdgfrb	UTSW	18	61077631	missense	probably benign	0.00
R4327:Pdgfrb	UTSW	18	61071720	missense	possibly damaging	0.83
R4329:Pdgfrb	UTSW	18	61071720	missense	possibly damaging	0.83
R4598:Pdgfrb	UTSW	18	61068757	missense	probably benign	0.03
R4668:Pdgfrb	UTSW	18	61064113	missense	probably damaging	1.00
R4761:Pdgfrb	UTSW	18	61079700	missense	probably damaging	1.00
R4787:Pdgfrb	UTSW	18	61079687	missense	probably damaging	1.00
R4828:Pdgfrb	UTSW	18	61073243	missense	probably damaging	0.98
R5030:Pdgfrb	UTSW	18	61065135	missense	probably benign	0.13
R5033:Pdgfrb	UTSW	18	61077668	missense	probably damaging	1.00
R5447:Pdgfrb	UTSW	18	61068108	missense	probably damaging	1.00
R6224:Pdgfrb	UTSW	18	61081939	nonsense	probably null
R6807:Pdgfrb	UTSW	18	61078649	critical splice donor site	probably null
R6858:Pdgfrb	UTSW	18	61065147	missense	probably benign	0.01
R7017:Pdgfrb	UTSW	18	61081004	missense	probably benign	0.00
R7089:Pdgfrb	UTSW	18	61073243	missense	probably damaging	1.00
R7174:Pdgfrb	UTSW	18	61066515	missense	probably benign
R7374:Pdgfrb	UTSW	18	61071708	missense	possibly damaging	0.64
R7496:Pdgfrb	UTSW	18	61078932	missense	possibly damaging	0.71
R7565:Pdgfrb	UTSW	18	61083264	missense	probably damaging	1.00
R7615:Pdgfrb	UTSW	18	61064046	missense	probably benign	0.00
R7691:Pdgfrb	UTSW	18	61061268	missense	probably benign	0.05
R7884:Pdgfrb	UTSW	18	61072658	missense	probably damaging	1.00
R8481:Pdgfrb	UTSW	18	61065742	missense	probably benign	0.03
R8735:Pdgfrb	UTSW	18	61063977	missense	probably benign	0.26
R8737:Pdgfrb	UTSW	18	61081001	missense	probably damaging	1.00
R9067:Pdgfrb	UTSW	18	61068219	missense	probably null	0.93
R9106:Pdgfrb	UTSW	18	61046028	critical splice acceptor site	probably null
R9161:Pdgfrb	UTSW	18	61063981	missense	probably damaging	1.00
R9234:Pdgfrb	UTSW	18	61061228	missense	probably null	0.00
R9380:Pdgfrb	UTSW	18	61064848	missense	probably damaging	1.00
R9452:Pdgfrb	UTSW	18	61065726	missense	possibly damaging	0.77
R9491:Pdgfrb	UTSW	18	61078984	missense	probably damaging	1.00
R9646:Pdgfrb	UTSW	18	61078649	critical splice donor site	probably null
R9717:Pdgfrb	UTSW	18	61072715	nonsense	probably null
X0060:Pdgfrb	UTSW	18	61081976	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTTATGGTACACGCAAAGTAACCC -3'
(R):5'- CTCGGTGAACACACTGGATCAAGG -3'

Sequencing Primer
(F):5'- GTAACCCATAACCCTCTGCTC -3'
(R):5'- AAGACCCTCTGGGTCAGC -3'

Posted On

2013-07-11