Incidental Mutation 'R0629:Cacna1f'
ID57791
Institutional Source Beutler Lab
Gene Symbol Cacna1f
Ensembl Gene ENSMUSG00000031142
Gene Namecalcium channel, voltage-dependent, alpha 1F subunit
SynonymsCav1.4, Sfc17
MMRRC Submission 038818-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0629 (G1)
Quality Score225
Status Validated
ChromosomeX
Chromosomal Location7607083-7635196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 7620434 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 888 (S888N)
Ref Sequence ENSEMBL: ENSMUSP00000111391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115725] [ENSMUST00000115726] [ENSMUST00000133637] [ENSMUST00000155090]
Predicted Effect probably damaging
Transcript: ENSMUST00000115725
AA Change: S888N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111390
Gene: ENSMUSG00000031142
AA Change: S888N

DomainStartEndE-ValueType
Pfam:Ion_trans 129 371 9.3e-59 PFAM
PDB:4DEY|B 372 415 2e-21 PDB
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
Pfam:Ion_trans 563 757 3.8e-44 PFAM
coiled coil region 806 834 N/A INTRINSIC
Pfam:Ion_trans 909 1139 1.1e-50 PFAM
Pfam:Ion_trans 1227 1436 2.7e-64 PFAM
Pfam:PKD_channel 1272 1443 1e-10 PFAM
Blast:EFh 1457 1485 2e-8 BLAST
Ca_chan_IQ 1571 1605 3.71e-14 SMART
low complexity region 1636 1655 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115726
AA Change: S888N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111391
Gene: ENSMUSG00000031142
AA Change: S888N

DomainStartEndE-ValueType
Pfam:Ion_trans 91 383 2.1e-70 PFAM
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
Pfam:Ion_trans 528 768 3.8e-54 PFAM
coiled coil region 806 834 N/A INTRINSIC
Pfam:Ion_trans 873 1151 2.4e-59 PFAM
Pfam:Ion_trans 1192 1455 2.6e-67 PFAM
Pfam:PKD_channel 1285 1450 8.5e-10 PFAM
Pfam:GPHH 1457 1526 2.7e-37 PFAM
Ca_chan_IQ 1578 1612 3.71e-14 SMART
Pfam:CAC1F_C 1622 1983 1.5e-164 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133637
SMART Domains Protein: ENSMUSP00000116051
Gene: ENSMUSG00000031142

DomainStartEndE-ValueType
transmembrane domain 96 115 N/A INTRINSIC
Pfam:Ion_trans 129 371 4.8e-59 PFAM
PDB:4DEY|B 372 415 9e-22 PDB
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
Pfam:Ion_trans 563 757 2.2e-44 PFAM
low complexity region 822 832 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144522
Predicted Effect probably benign
Transcript: ENSMUST00000155090
SMART Domains Protein: ENSMUSP00000138116
Gene: ENSMUSG00000031142

DomainStartEndE-ValueType
transmembrane domain 96 115 N/A INTRINSIC
Pfam:Ion_trans 129 371 1.1e-59 PFAM
PDB:4DEY|B 372 415 4e-22 PDB
Meta Mutation Damage Score 0.6801 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multipass transmembrane protein that functions as an alpha-1 subunit of the voltage-dependent calcium channel, which mediates the influx of calcium ions into the cell. The encoded protein forms a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Mutations in this gene can cause X-linked eye disorders, including congenital stationary night blindness type 2A, cone-rod dystropy, and Aland Island eye disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous or hemizygous mutation of this gene results in impaired eye electrophysiology, abnormal retinal neuronal layer, bipolar cell, and horizontal cell morphology, and impaired retinal synapse morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars2 A T 17: 45,507,547 D86V probably damaging Het
Adamts14 G A 10: 61,211,624 Q733* probably null Het
Adcy10 A G 1: 165,543,105 D651G probably damaging Het
Apcdd1 T A 18: 62,933,970 C52S probably damaging Het
Bclaf1 T C 10: 20,333,426 S463P probably damaging Het
Cabcoco1 T C 10: 68,516,278 Y68C probably damaging Het
Cacna1g A G 11: 94,409,543 C2134R possibly damaging Het
Cdc37 A C 9: 21,140,768 M325R possibly damaging Het
Clca2 T A 3: 145,072,239 M762L probably benign Het
Cntn3 C T 6: 102,203,976 V753M probably damaging Het
Col6a6 A T 9: 105,727,165 probably benign Het
Dscaml1 A G 9: 45,721,418 D1194G probably damaging Het
Egfr G A 11: 16,869,333 G288S probably damaging Het
Fbxl17 G T 17: 63,471,414 N19K probably damaging Het
Fmo3 A G 1: 162,958,227 probably benign Het
Frmd6 T C 12: 70,883,762 Y219H probably damaging Het
Fuca1 T C 4: 135,925,644 V193A possibly damaging Het
Gm1141 G C X: 71,938,773 R296P possibly damaging Het
Gm7461 C T 8: 4,677,769 noncoding transcript Het
Gpc5 T A 14: 115,552,239 N508K possibly damaging Het
Iqch A T 9: 63,425,382 D1019E probably benign Het
Isyna1 A G 8: 70,594,708 Y27C probably damaging Het
Itgb8 T G 12: 119,202,481 H105P probably benign Het
Kbtbd11 C T 8: 15,027,572 P57L probably benign Het
Kcns3 A C 12: 11,092,558 C47G probably damaging Het
Kif21b A T 1: 136,172,157 probably null Het
Lama3 A T 18: 12,419,245 H418L possibly damaging Het
Lrit3 A G 3: 129,788,302 Y679H probably damaging Het
Lrrc19 T A 4: 94,638,252 D356V probably damaging Het
Morc2b A G 17: 33,135,807 M997T probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Mtcl1 A T 17: 66,338,142 S1886T possibly damaging Het
Muc20 T C 16: 32,793,421 T529A possibly damaging Het
Myo7a A C 7: 98,085,466 L607R probably damaging Het
Myom2 T A 8: 15,069,783 F180I probably damaging Het
Myt1l G A 12: 29,811,485 E89K unknown Het
Nek2 A G 1: 191,831,317 N431S probably benign Het
Olfr1086 T A 2: 86,676,529 H268L possibly damaging Het
Olfr169 A T 16: 19,565,980 V301E possibly damaging Het
Oprm1 A T 10: 6,832,604 probably null Het
Oxsr1 A G 9: 119,241,784 probably benign Het
Pdgfrb G A 18: 61,078,648 probably null Het
Proser1 C A 3: 53,479,064 P789Q probably benign Het
Ptgs2 A G 1: 150,101,037 Q7R probably benign Het
Rab3d A G 9: 21,914,686 V144A probably benign Het
Ralgapb T A 2: 158,439,547 L167H probably damaging Het
Ranbp3 A G 17: 56,708,200 T301A possibly damaging Het
Rasgrf1 G A 9: 89,984,269 V587M probably damaging Het
Sec16b A G 1: 157,564,863 probably benign Het
Sin3b T C 8: 72,753,536 probably benign Het
Slc10a2 T C 8: 5,098,562 S128G probably benign Het
Tbl1xr1 G A 3: 22,210,401 V507I probably benign Het
Tmem8b T G 4: 43,669,896 probably null Het
Trak1 A T 9: 121,367,167 T22S probably benign Het
Trim30d A G 7: 104,487,655 I114T probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Ttn T C 2: 76,828,130 probably benign Het
Vipr1 T A 9: 121,660,171 Y99* probably null Het
Vmn1r210 T C 13: 22,827,874 K81E probably damaging Het
Wwc1 T C 11: 35,853,472 Y841C probably benign Het
Xrcc4 A G 13: 90,000,905 probably benign Het
Zdhhc22 A T 12: 86,988,297 I127N probably damaging Het
Zdhhc7 A G 8: 120,088,046 L8P possibly damaging Het
Zfp664 C A 5: 124,885,595 L18I probably damaging Het
Other mutations in Cacna1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Cacna1f APN X 7631031 missense probably damaging 1.00
IGL01693:Cacna1f APN X 7625367 missense probably damaging 1.00
IGL02143:Cacna1f APN X 7613995 intron probably benign
IGL02167:Cacna1f APN X 7616019 missense probably damaging 1.00
IGL02381:Cacna1f APN X 7616068 missense probably damaging 1.00
IGL02466:Cacna1f APN X 7629405 splice site probably null
IGL03006:Cacna1f APN X 7626903 missense probably damaging 1.00
FR4304:Cacna1f UTSW X 7620061 utr 3 prime probably benign
FR4340:Cacna1f UTSW X 7620067 utr 3 prime probably benign
FR4548:Cacna1f UTSW X 7620058 utr 3 prime probably benign
R1791:Cacna1f UTSW X 7620439 missense probably damaging 0.99
R2507:Cacna1f UTSW X 7626448 unclassified probably null
R2508:Cacna1f UTSW X 7626448 unclassified probably null
R4195:Cacna1f UTSW X 7608930 missense probably damaging 1.00
R4365:Cacna1f UTSW X 7609974 missense probably damaging 1.00
R4366:Cacna1f UTSW X 7609974 missense probably damaging 1.00
Z1088:Cacna1f UTSW X 7610251 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCCAAACCAACCCGTGAGTG -3'
(R):5'- GACTCCTCTGTGTCTGCCCAAATAC -3'

Sequencing Primer
(F):5'- AACCCGTGAGTGTTGGGAATG -3'
(R):5'- CACTTCTCAGAGTATGGAAATGGC -3'
Posted On2013-07-11