Incidental Mutation 'R7453:Pcnt'
ID 577912
Institutional Source Beutler Lab
Gene Symbol Pcnt
Ensembl Gene ENSMUSG00000001151
Gene Name pericentrin (kendrin)
Synonyms m275Asp, m239Asp, Pcnt2
MMRRC Submission 045527-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7453 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 76187097-76278620 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76225284 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 1740 (H1740R)
Ref Sequence ENSEMBL: ENSMUSP00000151534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001179] [ENSMUST00000217838]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000001179
AA Change: H1740R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001179
Gene: ENSMUSG00000001151
AA Change: H1740R

DomainStartEndE-ValueType
internal_repeat_1 7 78 2.47e-5 PROSPERO
low complexity region 104 114 N/A INTRINSIC
coiled coil region 131 229 N/A INTRINSIC
internal_repeat_3 241 259 6.69e-5 PROSPERO
low complexity region 313 325 N/A INTRINSIC
internal_repeat_3 391 409 6.69e-5 PROSPERO
low complexity region 456 467 N/A INTRINSIC
coiled coil region 468 520 N/A INTRINSIC
coiled coil region 554 581 N/A INTRINSIC
low complexity region 652 666 N/A INTRINSIC
coiled coil region 727 787 N/A INTRINSIC
coiled coil region 871 916 N/A INTRINSIC
low complexity region 931 942 N/A INTRINSIC
low complexity region 969 985 N/A INTRINSIC
coiled coil region 1055 1383 N/A INTRINSIC
coiled coil region 1429 1481 N/A INTRINSIC
coiled coil region 1529 1567 N/A INTRINSIC
low complexity region 1614 1624 N/A INTRINSIC
internal_repeat_2 1916 1964 2.47e-5 PROSPERO
coiled coil region 2158 2178 N/A INTRINSIC
coiled coil region 2211 2279 N/A INTRINSIC
coiled coil region 2300 2421 N/A INTRINSIC
coiled coil region 2447 2526 N/A INTRINSIC
Pfam:PACT_coil_coil 2718 2797 5.8e-29 PFAM
internal_repeat_1 2820 2885 2.47e-5 PROSPERO
internal_repeat_2 2844 2891 2.47e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000217838
AA Change: H1740R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (122/122)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele display mitotic spindle misorientation, microcephaly, craniofacial developmental anomalies, such as cleft palate and eye defects, variable structural kidney and cardiovascular defects, and altered hemodynamics leading to heart failure and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A G 2: 155,845,309 (GRCm39) S32P possibly damaging Het
Acaca T C 11: 84,136,136 (GRCm39) V497A probably benign Het
Acox1 T C 11: 116,071,787 (GRCm39) T214A probably benign Het
Adgrb2 G A 4: 129,908,430 (GRCm39) probably null Het
Adh1 G A 3: 137,995,702 (GRCm39) probably null Het
Angptl1 G T 1: 156,672,421 (GRCm39) M82I probably benign Het
Arg1 A G 10: 24,791,674 (GRCm39) L269P probably damaging Het
Arid2 T G 15: 96,268,605 (GRCm39) V906G probably benign Het
Arid5b A T 10: 68,078,994 (GRCm39) H114Q probably benign Het
Atad5 T C 11: 80,009,969 (GRCm39) probably null Het
AU040320 G A 4: 126,729,493 (GRCm39) probably null Het
B230104I21Rik A T 4: 154,432,185 (GRCm39) T44S unknown Het
BC024063 G A 10: 81,945,991 (GRCm39) R537H possibly damaging Het
Bfsp2 A T 9: 103,330,306 (GRCm39) L177Q probably damaging Het
Birc5 C A 11: 117,743,507 (GRCm39) H80Q probably damaging Het
Bpifb9a T C 2: 154,106,615 (GRCm39) L382P probably damaging Het
Ces2c A T 8: 105,576,302 (GRCm39) N105I probably benign Het
Cfap91 A G 16: 38,141,841 (GRCm39) S364P possibly damaging Het
Cflar G A 1: 58,792,956 (GRCm39) V441M Het
Ckap4 A G 10: 84,364,463 (GRCm39) V200A probably damaging Het
Clec16a C A 16: 10,462,686 (GRCm39) T668N probably damaging Het
Cntrl A C 2: 35,045,421 (GRCm39) E1376D possibly damaging Het
Col18a1 A T 10: 76,921,044 (GRCm39) probably null Het
Coq2 T C 5: 100,811,452 (GRCm39) Y179C probably benign Het
Cpne6 A G 14: 55,749,473 (GRCm39) E11G probably benign Het
Cr2 A C 1: 194,847,565 (GRCm39) probably null Het
Csf2rb2 C T 15: 78,169,491 (GRCm39) D555N probably benign Het
Cyp2j12 A T 4: 95,990,363 (GRCm39) V401D possibly damaging Het
Dbp C T 7: 45,355,127 (GRCm39) A27V probably benign Het
Dll1 C A 17: 15,595,151 (GRCm39) R42L probably benign Het
Dst C A 1: 34,230,439 (GRCm39) H2677Q possibly damaging Het
Efl1 G T 7: 82,330,675 (GRCm39) V283F possibly damaging Het
Enah C T 1: 181,789,470 (GRCm39) C7Y unknown Het
Fam193a A T 5: 34,621,460 (GRCm39) E1139V possibly damaging Het
Fbn1 G A 2: 125,162,879 (GRCm39) P2136S possibly damaging Het
Fggy T C 4: 95,485,927 (GRCm39) V91A probably damaging Het
Fn1 T A 1: 71,630,039 (GRCm39) D2343V probably damaging Het
Galk2 T C 2: 125,729,781 (GRCm39) V54A possibly damaging Het
Glb1l T A 1: 75,179,350 (GRCm39) Y193F probably damaging Het
Gm45861 G T 8: 28,031,686 (GRCm39) R867L unknown Het
Grin2b T C 6: 135,717,947 (GRCm39) D715G possibly damaging Het
Hltf A T 3: 20,136,916 (GRCm39) R384S possibly damaging Het
Hs3st1 A G 5: 39,772,310 (GRCm39) M111T probably damaging Het
Idua A G 5: 108,829,362 (GRCm39) T388A probably benign Het
Kat14 T C 2: 144,222,654 (GRCm39) S136P possibly damaging Het
Kif24 A C 4: 41,394,673 (GRCm39) C867W possibly damaging Het
Klhdc10 T A 6: 30,447,989 (GRCm39) probably null Het
Klra10 A G 6: 130,257,327 (GRCm39) V59A probably damaging Het
Limk1 T A 5: 134,698,091 (GRCm39) I223F probably damaging Het
Lrp10 G A 14: 54,705,913 (GRCm39) G368S probably damaging Het
Lrrc7 T C 3: 157,891,046 (GRCm39) R374G probably benign Het
Lypd1 T A 1: 125,801,303 (GRCm39) M66L probably benign Het
Mast4 C T 13: 102,941,149 (GRCm39) probably null Het
Mbp C T 18: 82,572,768 (GRCm39) H155Y probably damaging Het
Micu3 G A 8: 40,788,939 (GRCm39) C150Y probably benign Het
Mras C T 9: 99,271,793 (GRCm39) V174I probably benign Het
Mroh1 T A 15: 76,317,745 (GRCm39) I827N probably damaging Het
Ms4a12 C A 19: 11,203,026 (GRCm39) G101* probably null Het
Mylk2 A T 2: 152,754,353 (GRCm39) K149M probably damaging Het
Myom3 T A 4: 135,528,346 (GRCm39) L1064I probably damaging Het
Naa30 A G 14: 49,425,144 (GRCm39) *365W probably null Het
Ncoa1 C T 12: 4,309,307 (GRCm39) G1330R probably damaging Het
Nhlh1 T A 1: 171,881,846 (GRCm39) T7S probably benign Het
Nipsnap3a A G 4: 52,995,882 (GRCm39) Q110R probably benign Het
Nostrin T C 2: 69,014,240 (GRCm39) Y399H possibly damaging Het
Nsfl1c C A 2: 151,351,431 (GRCm39) T263K possibly damaging Het
Nup153 T C 13: 46,834,657 (GRCm39) T1456A probably damaging Het
Or14j10 G T 17: 37,935,276 (GRCm39) D83E probably benign Het
Or1o2 T C 17: 37,542,871 (GRCm39) Y130C probably damaging Het
Or51e1 T A 7: 102,358,724 (GRCm39) I86N probably damaging Het
Or52z1 T A 7: 103,436,879 (GRCm39) I202F possibly damaging Het
Or5g26 T A 2: 85,494,524 (GRCm39) M85L probably benign Het
Or8d1b A T 9: 38,887,500 (GRCm39) H176L probably damaging Het
Pan3 G A 5: 147,463,491 (GRCm39) probably null Het
Pcdhgb2 C T 18: 37,824,068 (GRCm39) T353I probably damaging Het
Pcif1 A T 2: 164,730,284 (GRCm39) H339L probably damaging Het
Pcif1 A G 2: 164,731,550 (GRCm39) H501R possibly damaging Het
Polr1b T A 2: 128,967,583 (GRCm39) I992N probably damaging Het
Ppfia2 C T 10: 106,763,691 (GRCm39) T1228M possibly damaging Het
Ppp2r5e A G 12: 75,509,116 (GRCm39) F388L probably damaging Het
Ptpre G T 7: 135,139,803 (GRCm39) R4L unknown Het
Pzp G T 6: 128,463,879 (GRCm39) P1410T probably damaging Het
Qrich1 A C 9: 108,433,675 (GRCm39) K656T possibly damaging Het
Rabep1 C T 11: 70,808,486 (GRCm39) P481S probably damaging Het
Rgs9 T A 11: 109,118,094 (GRCm39) R579W probably damaging Het
Rhot1 T C 11: 80,139,366 (GRCm39) probably null Het
Rnf123 T A 9: 107,947,607 (GRCm39) probably null Het
Rreb1 T G 13: 38,125,545 (GRCm39) C1284G probably damaging Het
Rsph4a A G 10: 33,785,289 (GRCm39) E400G probably benign Het
Rufy4 T A 1: 74,168,493 (GRCm39) probably null Het
S100pbp A G 4: 129,075,878 (GRCm39) L149P probably damaging Het
Sall3 T C 18: 81,015,255 (GRCm39) D891G probably benign Het
Scn10a C T 9: 119,467,618 (GRCm39) V841I probably benign Het
Scn5a T A 9: 119,351,656 (GRCm39) Y775F possibly damaging Het
Sec62 A T 3: 30,863,945 (GRCm39) probably null Het
Slc24a1 A T 9: 64,856,583 (GRCm39) M108K unknown Het
Spata22 T A 11: 73,226,816 (GRCm39) probably null Het
Spmap2l A G 5: 77,208,633 (GRCm39) H387R probably damaging Het
Stk4 A G 2: 163,928,522 (GRCm39) N118S probably benign Het
Stt3a A T 9: 36,659,266 (GRCm39) S358T possibly damaging Het
Tbc1d31 T A 15: 57,814,391 (GRCm39) F531I probably damaging Het
Tfrc A G 16: 32,437,867 (GRCm39) T307A probably damaging Het
Tnpo2 T C 8: 85,781,651 (GRCm39) I811T probably damaging Het
Ttc23l T C 15: 10,533,853 (GRCm39) Y230C probably damaging Het
Ttll13 A G 7: 79,910,182 (GRCm39) D775G probably benign Het
Ttn T C 2: 76,775,273 (GRCm39) K1969R unknown Het
Ube2s G A 7: 4,813,435 (GRCm39) R110* probably null Het
Ubxn11 G A 4: 133,853,540 (GRCm39) R364Q probably benign Het
Unc13d T C 11: 115,958,697 (GRCm39) Q773R probably benign Het
Ush2a T C 1: 188,285,308 (GRCm39) V1948A probably damaging Het
Vmn1r205 A T 13: 22,776,931 (GRCm39) I57N probably damaging Het
Vmn2r69 GAAAA GAAAAA 7: 85,060,768 (GRCm39) probably null Het
Vmn2r71 A T 7: 85,273,297 (GRCm39) T704S probably benign Het
Vmn2r93 T A 17: 18,533,580 (GRCm39) S495T probably benign Het
Wiz T A 17: 32,598,049 (GRCm39) I102F probably benign Het
Zan A C 5: 137,464,264 (GRCm39) L514V probably damaging Het
Zfp106 T A 2: 120,341,008 (GRCm39) N1857I probably damaging Het
Zfp106 A T 2: 120,376,400 (GRCm39) probably null Het
Zfp738 T C 13: 67,818,474 (GRCm39) T506A probably benign Het
Zfp934 T C 13: 62,666,517 (GRCm39) N53S probably benign Het
Other mutations in Pcnt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Pcnt APN 10 76,258,738 (GRCm39) nonsense probably null
IGL01307:Pcnt APN 10 76,247,422 (GRCm39) missense probably damaging 1.00
IGL01549:Pcnt APN 10 76,203,320 (GRCm39) splice site probably null
IGL01576:Pcnt APN 10 76,204,656 (GRCm39) missense probably damaging 0.99
IGL01611:Pcnt APN 10 76,272,258 (GRCm39) critical splice donor site probably null
IGL01630:Pcnt APN 10 76,256,080 (GRCm39) missense probably damaging 0.99
IGL01647:Pcnt APN 10 76,205,835 (GRCm39) nonsense probably null
IGL01689:Pcnt APN 10 76,247,487 (GRCm39) missense probably damaging 1.00
IGL01690:Pcnt APN 10 76,228,609 (GRCm39) missense probably damaging 1.00
IGL01723:Pcnt APN 10 76,254,333 (GRCm39) missense possibly damaging 0.63
IGL01920:Pcnt APN 10 76,240,362 (GRCm39) missense probably damaging 1.00
IGL01958:Pcnt APN 10 76,269,513 (GRCm39) missense probably damaging 0.96
IGL02210:Pcnt APN 10 76,225,053 (GRCm39) missense possibly damaging 0.95
IGL02225:Pcnt APN 10 76,225,308 (GRCm39) missense probably benign 0.00
IGL02228:Pcnt APN 10 76,225,308 (GRCm39) missense probably benign 0.00
IGL02237:Pcnt APN 10 76,188,818 (GRCm39) missense probably damaging 1.00
IGL02279:Pcnt APN 10 76,239,599 (GRCm39) missense probably damaging 1.00
IGL02303:Pcnt APN 10 76,278,393 (GRCm39) splice site probably benign
IGL02355:Pcnt APN 10 76,210,996 (GRCm39) nonsense probably null
IGL02362:Pcnt APN 10 76,210,996 (GRCm39) nonsense probably null
IGL02428:Pcnt APN 10 76,265,090 (GRCm39) missense probably damaging 0.99
IGL02536:Pcnt APN 10 76,216,063 (GRCm39) missense possibly damaging 0.68
IGL02715:Pcnt APN 10 76,204,556 (GRCm39) splice site probably benign
IGL02800:Pcnt APN 10 76,248,417 (GRCm39) nonsense probably null
IGL03395:Pcnt APN 10 76,272,325 (GRCm39) missense possibly damaging 0.95
IGL02799:Pcnt UTSW 10 76,248,417 (GRCm39) nonsense probably null
PIT4520001:Pcnt UTSW 10 76,256,069 (GRCm39) missense probably damaging 0.99
R0049:Pcnt UTSW 10 76,205,655 (GRCm39) unclassified probably benign
R0049:Pcnt UTSW 10 76,205,655 (GRCm39) unclassified probably benign
R0109:Pcnt UTSW 10 76,225,030 (GRCm39) missense probably benign 0.00
R0117:Pcnt UTSW 10 76,244,561 (GRCm39) nonsense probably null
R0254:Pcnt UTSW 10 76,228,414 (GRCm39) missense probably benign 0.10
R0392:Pcnt UTSW 10 76,220,660 (GRCm39) missense probably benign
R0511:Pcnt UTSW 10 76,240,429 (GRCm39) missense possibly damaging 0.66
R0570:Pcnt UTSW 10 76,247,941 (GRCm39) missense probably damaging 1.00
R0614:Pcnt UTSW 10 76,256,150 (GRCm39) missense probably damaging 1.00
R0635:Pcnt UTSW 10 76,240,419 (GRCm39) missense probably damaging 1.00
R0707:Pcnt UTSW 10 76,256,375 (GRCm39) missense probably damaging 1.00
R0749:Pcnt UTSW 10 76,217,198 (GRCm39) missense probably damaging 1.00
R0969:Pcnt UTSW 10 76,263,785 (GRCm39) missense probably damaging 1.00
R1172:Pcnt UTSW 10 76,228,878 (GRCm39) splice site probably null
R1174:Pcnt UTSW 10 76,228,878 (GRCm39) splice site probably null
R1175:Pcnt UTSW 10 76,228,878 (GRCm39) splice site probably null
R1512:Pcnt UTSW 10 76,240,496 (GRCm39) splice site probably null
R1542:Pcnt UTSW 10 76,237,220 (GRCm39) missense probably benign 0.02
R1542:Pcnt UTSW 10 76,225,221 (GRCm39) missense probably benign 0.08
R1558:Pcnt UTSW 10 76,258,756 (GRCm39) missense possibly damaging 0.53
R1562:Pcnt UTSW 10 76,203,164 (GRCm39) missense probably benign 0.02
R1762:Pcnt UTSW 10 76,190,971 (GRCm39) critical splice acceptor site probably null
R1779:Pcnt UTSW 10 76,244,630 (GRCm39) missense probably damaging 0.99
R1869:Pcnt UTSW 10 76,215,740 (GRCm39) missense probably null 0.94
R1911:Pcnt UTSW 10 76,204,650 (GRCm39) missense possibly damaging 0.94
R1985:Pcnt UTSW 10 76,216,171 (GRCm39) missense possibly damaging 0.95
R1995:Pcnt UTSW 10 76,228,633 (GRCm39) nonsense probably null
R2073:Pcnt UTSW 10 76,216,214 (GRCm39) missense possibly damaging 0.92
R2111:Pcnt UTSW 10 76,256,360 (GRCm39) missense probably damaging 0.99
R2112:Pcnt UTSW 10 76,256,360 (GRCm39) missense probably damaging 0.99
R2309:Pcnt UTSW 10 76,278,460 (GRCm39) start gained probably benign
R2902:Pcnt UTSW 10 76,211,064 (GRCm39) missense probably damaging 0.98
R3623:Pcnt UTSW 10 76,269,584 (GRCm39) missense probably benign 0.23
R4088:Pcnt UTSW 10 76,263,848 (GRCm39) missense probably damaging 1.00
R4300:Pcnt UTSW 10 76,203,225 (GRCm39) missense probably benign 0.40
R4402:Pcnt UTSW 10 76,228,227 (GRCm39) missense probably benign 0.00
R4407:Pcnt UTSW 10 76,210,704 (GRCm39) missense possibly damaging 0.90
R4483:Pcnt UTSW 10 76,237,317 (GRCm39) missense probably damaging 1.00
R4647:Pcnt UTSW 10 76,190,047 (GRCm39) missense probably benign 0.01
R4734:Pcnt UTSW 10 76,273,040 (GRCm39) missense probably benign 0.25
R4747:Pcnt UTSW 10 76,272,299 (GRCm39) missense possibly damaging 0.91
R4782:Pcnt UTSW 10 76,245,411 (GRCm39) missense possibly damaging 0.62
R4795:Pcnt UTSW 10 76,205,858 (GRCm39) missense probably benign 0.21
R4831:Pcnt UTSW 10 76,248,335 (GRCm39) missense probably damaging 0.96
R4873:Pcnt UTSW 10 76,205,688 (GRCm39) missense probably benign 0.03
R4875:Pcnt UTSW 10 76,205,688 (GRCm39) missense probably benign 0.03
R4946:Pcnt UTSW 10 76,192,019 (GRCm39) missense probably damaging 1.00
R5032:Pcnt UTSW 10 76,190,911 (GRCm39) missense probably benign 0.00
R5033:Pcnt UTSW 10 76,235,779 (GRCm39) missense possibly damaging 0.95
R5106:Pcnt UTSW 10 76,237,278 (GRCm39) missense probably damaging 1.00
R5118:Pcnt UTSW 10 76,248,002 (GRCm39) missense probably damaging 0.98
R5167:Pcnt UTSW 10 76,256,258 (GRCm39) missense probably damaging 0.97
R5199:Pcnt UTSW 10 76,254,378 (GRCm39) missense probably benign 0.09
R5223:Pcnt UTSW 10 76,216,106 (GRCm39) missense probably damaging 0.99
R5241:Pcnt UTSW 10 76,269,451 (GRCm39) missense probably benign 0.26
R5308:Pcnt UTSW 10 76,192,159 (GRCm39) nonsense probably null
R5328:Pcnt UTSW 10 76,247,553 (GRCm39) missense probably damaging 1.00
R5454:Pcnt UTSW 10 76,225,381 (GRCm39) splice site probably null
R5543:Pcnt UTSW 10 76,247,886 (GRCm39) missense probably benign 0.01
R5588:Pcnt UTSW 10 76,278,445 (GRCm39) missense possibly damaging 0.74
R5647:Pcnt UTSW 10 76,221,675 (GRCm39) missense probably benign 0.17
R5668:Pcnt UTSW 10 76,245,334 (GRCm39) missense probably benign 0.16
R5712:Pcnt UTSW 10 76,265,105 (GRCm39) missense probably damaging 0.96
R5714:Pcnt UTSW 10 76,256,325 (GRCm39) missense probably damaging 1.00
R5797:Pcnt UTSW 10 76,228,590 (GRCm39) missense probably benign 0.00
R5946:Pcnt UTSW 10 76,217,897 (GRCm39) missense possibly damaging 0.91
R5955:Pcnt UTSW 10 76,247,456 (GRCm39) missense possibly damaging 0.45
R6024:Pcnt UTSW 10 76,255,871 (GRCm39) missense possibly damaging 0.87
R6267:Pcnt UTSW 10 76,221,632 (GRCm39) missense probably benign 0.02
R6485:Pcnt UTSW 10 76,225,164 (GRCm39) nonsense probably null
R6605:Pcnt UTSW 10 76,265,032 (GRCm39) critical splice donor site probably null
R6877:Pcnt UTSW 10 76,269,851 (GRCm39) missense possibly damaging 0.94
R6882:Pcnt UTSW 10 76,263,662 (GRCm39) missense probably benign 0.00
R6919:Pcnt UTSW 10 76,221,632 (GRCm39) missense probably benign 0.02
R7025:Pcnt UTSW 10 76,239,669 (GRCm39) missense probably damaging 1.00
R7098:Pcnt UTSW 10 76,220,673 (GRCm39) missense probably benign
R7109:Pcnt UTSW 10 76,205,738 (GRCm39) missense probably damaging 1.00
R7121:Pcnt UTSW 10 76,263,761 (GRCm39) missense possibly damaging 0.73
R7143:Pcnt UTSW 10 76,224,894 (GRCm39) missense possibly damaging 0.47
R7152:Pcnt UTSW 10 76,247,194 (GRCm39) splice site probably null
R7213:Pcnt UTSW 10 76,244,738 (GRCm39) missense probably damaging 1.00
R7368:Pcnt UTSW 10 76,235,835 (GRCm39) missense probably benign
R7486:Pcnt UTSW 10 76,254,271 (GRCm39) missense probably benign
R7486:Pcnt UTSW 10 76,254,270 (GRCm39) missense probably benign 0.03
R7538:Pcnt UTSW 10 76,235,773 (GRCm39) missense probably benign
R7575:Pcnt UTSW 10 76,225,086 (GRCm39) missense probably benign 0.32
R7662:Pcnt UTSW 10 76,223,356 (GRCm39) missense probably benign 0.27
R7685:Pcnt UTSW 10 76,258,642 (GRCm39) missense probably benign 0.14
R7764:Pcnt UTSW 10 76,190,082 (GRCm39) missense probably benign 0.33
R7802:Pcnt UTSW 10 76,211,137 (GRCm39) splice site probably null
R8432:Pcnt UTSW 10 76,256,039 (GRCm39) missense probably damaging 1.00
R8439:Pcnt UTSW 10 76,256,039 (GRCm39) missense probably damaging 1.00
R8493:Pcnt UTSW 10 76,239,457 (GRCm39) critical splice donor site probably null
R8530:Pcnt UTSW 10 76,256,039 (GRCm39) missense probably damaging 1.00
R8535:Pcnt UTSW 10 76,256,039 (GRCm39) missense probably damaging 1.00
R8830:Pcnt UTSW 10 76,218,008 (GRCm39) missense probably benign 0.03
R8878:Pcnt UTSW 10 76,244,675 (GRCm39) missense probably damaging 1.00
R8911:Pcnt UTSW 10 76,223,359 (GRCm39) missense probably damaging 0.98
R8988:Pcnt UTSW 10 76,245,407 (GRCm39) nonsense probably null
R9084:Pcnt UTSW 10 76,235,826 (GRCm39) missense probably benign 0.09
R9169:Pcnt UTSW 10 76,221,572 (GRCm39) missense possibly damaging 0.95
R9372:Pcnt UTSW 10 76,258,960 (GRCm39) missense probably damaging 1.00
R9411:Pcnt UTSW 10 76,258,896 (GRCm39) missense probably damaging 0.96
R9448:Pcnt UTSW 10 76,256,360 (GRCm39) missense probably damaging 0.99
R9459:Pcnt UTSW 10 76,228,572 (GRCm39) missense probably damaging 1.00
R9479:Pcnt UTSW 10 76,217,963 (GRCm39) missense probably benign 0.00
R9503:Pcnt UTSW 10 76,263,882 (GRCm39) missense possibly damaging 0.59
R9561:Pcnt UTSW 10 76,217,128 (GRCm39) nonsense probably null
R9618:Pcnt UTSW 10 76,188,794 (GRCm39) missense probably damaging 1.00
R9648:Pcnt UTSW 10 76,190,089 (GRCm39) missense probably benign 0.32
R9733:Pcnt UTSW 10 76,237,314 (GRCm39) missense probably benign 0.01
Z1176:Pcnt UTSW 10 76,217,991 (GRCm39) nonsense probably null
Z1177:Pcnt UTSW 10 76,235,802 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGGCATTTCAACTTGGACC -3'
(R):5'- ACCCAACTTTCAAGCTTTAGTTCTG -3'

Sequencing Primer
(F):5'- TTTCAACTTGGACCAACAAATCCTG -3'
(R):5'- AAGCTTTAGTTCTGTTTTCTATGCC -3'
Posted On 2019-10-07