Incidental Mutation 'R7453:Mast4'
ID577931
Institutional Source Beutler Lab
Gene Symbol Mast4
Ensembl Gene ENSMUSG00000034751
Gene Namemicrotubule associated serine/threonine kinase family member 4
Synonyms4930420O11Rik
MMRRC Submission
Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791ENSMUST00000091273

Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R7453 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location102732486-103334497 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 102804641 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166336] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000171791] [ENSMUST00000172264]
Predicted Effect probably null
Transcript: ENSMUST00000099202
SMART Domains Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 13 38 N/A INTRINSIC
Pfam:DUF1908 76 353 2.2e-146 PFAM
S_TKc 391 664 4.13e-98 SMART
S_TK_X 665 729 3.79e-2 SMART
low complexity region 745 758 N/A INTRINSIC
low complexity region 818 831 N/A INTRINSIC
low complexity region 840 857 N/A INTRINSIC
low complexity region 925 960 N/A INTRINSIC
PDZ 970 1050 2.34e-15 SMART
low complexity region 1070 1087 N/A INTRINSIC
low complexity region 1111 1122 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1142 1164 N/A INTRINSIC
low complexity region 1202 1219 N/A INTRINSIC
low complexity region 1290 1306 N/A INTRINSIC
low complexity region 1345 1361 N/A INTRINSIC
low complexity region 1937 1953 N/A INTRINSIC
low complexity region 1996 2010 N/A INTRINSIC
low complexity region 2150 2161 N/A INTRINSIC
low complexity region 2296 2307 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166336
SMART Domains Protein: ENSMUSP00000126516
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 71 212 1.2e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000166726
SMART Domains Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 530 4.2e-145 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1035 1070 N/A INTRINSIC
PDZ 1080 1160 2.34e-15 SMART
low complexity region 1180 1201 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167058
SMART Domains Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
low complexity region 23 51 N/A INTRINSIC
Pfam:DUF1908 256 529 5.1e-134 PFAM
S_TKc 568 841 4.13e-98 SMART
S_TK_X 842 906 3.79e-2 SMART
low complexity region 922 935 N/A INTRINSIC
low complexity region 995 1008 N/A INTRINSIC
low complexity region 1017 1034 N/A INTRINSIC
low complexity region 1102 1137 N/A INTRINSIC
PDZ 1147 1227 2.34e-15 SMART
low complexity region 1247 1264 N/A INTRINSIC
low complexity region 1288 1299 N/A INTRINSIC
low complexity region 1304 1316 N/A INTRINSIC
low complexity region 1319 1341 N/A INTRINSIC
low complexity region 1379 1396 N/A INTRINSIC
low complexity region 1467 1483 N/A INTRINSIC
low complexity region 1522 1538 N/A INTRINSIC
low complexity region 2114 2130 N/A INTRINSIC
low complexity region 2173 2187 N/A INTRINSIC
low complexity region 2327 2338 N/A INTRINSIC
low complexity region 2473 2484 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167462
SMART Domains Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 3e-145 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 843 878 N/A INTRINSIC
PDZ 888 968 2.34e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171791
SMART Domains Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 64 338 1.2e-144 PFAM
S_TKc 376 649 4.13e-98 SMART
S_TK_X 650 714 3.79e-2 SMART
low complexity region 730 743 N/A INTRINSIC
low complexity region 803 816 N/A INTRINSIC
low complexity region 825 842 N/A INTRINSIC
low complexity region 910 945 N/A INTRINSIC
PDZ 955 1035 2.34e-15 SMART
low complexity region 1055 1072 N/A INTRINSIC
low complexity region 1096 1107 N/A INTRINSIC
low complexity region 1112 1124 N/A INTRINSIC
low complexity region 1127 1149 N/A INTRINSIC
low complexity region 1187 1204 N/A INTRINSIC
low complexity region 1275 1291 N/A INTRINSIC
low complexity region 1330 1346 N/A INTRINSIC
low complexity region 1922 1938 N/A INTRINSIC
low complexity region 1981 1995 N/A INTRINSIC
low complexity region 2135 2146 N/A INTRINSIC
low complexity region 2281 2292 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172264
SMART Domains Protein: ENSMUSP00000128129
Gene: ENSMUSG00000034751

DomainStartEndE-ValueType
Pfam:DUF1908 49 326 4.1e-147 PFAM
S_TKc 364 637 4.13e-98 SMART
S_TK_X 638 702 3.79e-2 SMART
low complexity region 718 731 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
low complexity region 813 830 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000194446
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (122/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A G 2: 156,003,389 S32P possibly damaging Het
Acaca T C 11: 84,245,310 V497A probably benign Het
Acox1 T C 11: 116,180,961 T214A probably benign Het
Adgrb2 G A 4: 130,014,637 probably null Het
Adh1 G A 3: 138,289,941 probably null Het
Angptl1 G T 1: 156,844,851 M82I probably benign Het
Arg1 A G 10: 24,915,776 L269P probably damaging Het
Arid2 T G 15: 96,370,724 V906G probably benign Het
Arid5b A T 10: 68,243,164 H114Q probably benign Het
Atad5 T C 11: 80,119,143 probably null Het
AU040320 G A 4: 126,835,700 probably null Het
B230104I21Rik A T 4: 154,347,728 T44S unknown Het
BC024063 G A 10: 82,110,157 R537H possibly damaging Het
Bfsp2 A T 9: 103,453,107 L177Q probably damaging Het
Birc5 C A 11: 117,852,681 H80Q probably damaging Het
Bpifb9a T C 2: 154,264,695 L382P probably damaging Het
Ces2c A T 8: 104,849,670 N105I probably benign Het
Cflar G A 1: 58,753,797 V441M Het
Ckap4 A G 10: 84,528,599 V200A probably damaging Het
Clec16a C A 16: 10,644,822 T668N probably damaging Het
Cntrl A C 2: 35,155,409 E1376D possibly damaging Het
Col18a1 A T 10: 77,085,210 probably null Het
Coq2 T C 5: 100,663,586 Y179C probably benign Het
Cpne6 A G 14: 55,512,016 E11G probably benign Het
Cr2 A C 1: 195,165,257 probably null Het
Csf2rb2 C T 15: 78,285,291 D555N probably benign Het
Cyp2j12 A T 4: 96,102,126 V401D possibly damaging Het
Dbp C T 7: 45,705,703 A27V probably benign Het
Dll1 C A 17: 15,374,889 R42L probably benign Het
Dst C A 1: 34,191,358 H2677Q possibly damaging Het
Efl1 G T 7: 82,681,467 V283F possibly damaging Het
Enah C T 1: 181,961,905 C7Y unknown Het
Fam193a A T 5: 34,464,116 E1139V possibly damaging Het
Fbn1 G A 2: 125,320,959 P2136S possibly damaging Het
Fggy T C 4: 95,597,690 V91A probably damaging Het
Fn1 T A 1: 71,590,880 D2343V probably damaging Het
Galk2 T C 2: 125,887,861 V54A possibly damaging Het
Glb1l T A 1: 75,202,706 Y193F probably damaging Het
Gm45861 G T 8: 27,541,658 R867L unknown Het
Grin2b T C 6: 135,740,949 D715G possibly damaging Het
Hltf A T 3: 20,082,752 R384S possibly damaging Het
Hs3st1 A G 5: 39,614,967 M111T probably damaging Het
Idua A G 5: 108,681,496 T388A probably benign Het
Kat14 T C 2: 144,380,734 S136P possibly damaging Het
Kif24 A C 4: 41,394,673 C867W possibly damaging Het
Klhdc10 T A 6: 30,447,990 probably null Het
Klra10 A G 6: 130,280,364 V59A probably damaging Het
Limk1 T A 5: 134,669,237 I223F probably damaging Het
Lrp10 G A 14: 54,468,456 G368S probably damaging Het
Lrrc7 T C 3: 158,185,409 R374G probably benign Het
Lypd1 T A 1: 125,873,566 M66L probably benign Het
Maats1 A G 16: 38,321,479 S364P possibly damaging Het
Mbp C T 18: 82,554,643 H155Y probably damaging Het
Micu3 G A 8: 40,335,898 C150Y probably benign Het
Mras C T 9: 99,389,740 V174I probably benign Het
Mroh1 T A 15: 76,433,545 I827N probably damaging Het
Ms4a12 C A 19: 11,225,662 G101* probably null Het
Mylk2 A T 2: 152,912,433 K149M probably damaging Het
Myom3 T A 4: 135,801,035 L1064I probably damaging Het
Naa30 A G 14: 49,187,687 *365W probably null Het
Ncoa1 C T 12: 4,259,307 G1330R probably damaging Het
Nhlh1 T A 1: 172,054,279 T7S probably benign Het
Nipsnap3a A G 4: 52,995,882 Q110R probably benign Het
Nostrin T C 2: 69,183,896 Y399H possibly damaging Het
Nsfl1c C A 2: 151,509,511 T263K possibly damaging Het
Nup153 T C 13: 46,681,181 T1456A probably damaging Het
Olfr116 G T 17: 37,624,385 D83E probably benign Het
Olfr154 T A 2: 85,664,180 M85L probably benign Het
Olfr558 T A 7: 102,709,517 I86N probably damaging Het
Olfr67 T A 7: 103,787,672 I202F possibly damaging Het
Olfr933 A T 9: 38,976,204 H176L probably damaging Het
Olfr97 T C 17: 37,231,980 Y130C probably damaging Het
Pan3 G A 5: 147,526,681 probably null Het
Pcdhgb2 C T 18: 37,691,015 T353I probably damaging Het
Pcif1 A T 2: 164,888,364 H339L probably damaging Het
Pcif1 A G 2: 164,889,630 H501R possibly damaging Het
Pcnt T C 10: 76,389,450 H1740R probably benign Het
Polr1b T A 2: 129,125,663 I992N probably damaging Het
Ppfia2 C T 10: 106,927,830 T1228M possibly damaging Het
Ppp2r5e A G 12: 75,462,342 F388L probably damaging Het
Ptpre G T 7: 135,538,074 R4L unknown Het
Pzp G T 6: 128,486,916 P1410T probably damaging Het
Qrich1 A C 9: 108,556,476 K656T possibly damaging Het
Rabep1 C T 11: 70,917,660 P481S probably damaging Het
Rgs9 T A 11: 109,227,268 R579W probably damaging Het
Rhot1 T C 11: 80,248,540 probably null Het
Rnf123 T A 9: 108,070,408 probably null Het
Rreb1 T G 13: 37,941,569 C1284G probably damaging Het
Rsph4a A G 10: 33,909,293 E400G probably benign Het
Rufy4 T A 1: 74,129,334 probably null Het
S100pbp A G 4: 129,182,085 L149P probably damaging Het
Sall3 T C 18: 80,972,040 D891G probably benign Het
Scn10a C T 9: 119,638,552 V841I probably benign Het
Scn5a T A 9: 119,522,590 Y775F possibly damaging Het
Sec62 A T 3: 30,809,796 probably null Het
Slc24a1 A T 9: 64,949,301 M108K unknown Het
Spata22 T A 11: 73,335,990 probably null Het
Stk4 A G 2: 164,086,602 N118S probably benign Het
Stt3a A T 9: 36,747,970 S358T possibly damaging Het
Tbc1d31 T A 15: 57,950,995 F531I probably damaging Het
Tfrc A G 16: 32,619,049 T307A probably damaging Het
Thegl A G 5: 77,060,786 H387R probably damaging Het
Tnpo2 T C 8: 85,055,022 I811T probably damaging Het
Ttc23l T C 15: 10,533,767 Y230C probably damaging Het
Ttll13 A G 7: 80,260,434 D775G probably benign Het
Ttn T C 2: 76,944,929 K1969R unknown Het
Ube2s G A 7: 4,810,436 R110* probably null Het
Ubxn11 G A 4: 134,126,229 R364Q probably benign Het
Unc13d T C 11: 116,067,871 Q773R probably benign Het
Ush2a T C 1: 188,553,111 V1948A probably damaging Het
Vmn1r205 A T 13: 22,592,761 I57N probably damaging Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Vmn2r71 A T 7: 85,624,089 T704S probably benign Het
Vmn2r93 T A 17: 18,313,318 S495T probably benign Het
Wiz T A 17: 32,379,075 I102F probably benign Het
Zan A C 5: 137,466,002 L514V probably damaging Het
Zfp106 T A 2: 120,510,527 N1857I probably damaging Het
Zfp106 A T 2: 120,545,919 probably null Het
Zfp738 T C 13: 67,670,355 T506A probably benign Het
Zfp934 T C 13: 62,518,703 N53S probably benign Het
Other mutations in Mast4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Mast4 APN 13 102770767 nonsense probably null
IGL00933:Mast4 APN 13 102735366 missense probably damaging 0.97
IGL01113:Mast4 APN 13 102774236 missense probably damaging 1.00
IGL01461:Mast4 APN 13 102754068 missense probably damaging 1.00
IGL01569:Mast4 APN 13 102761015 missense probably damaging 1.00
IGL01697:Mast4 APN 13 102767893 missense probably damaging 1.00
IGL01725:Mast4 APN 13 102750512 critical splice donor site probably null
IGL01734:Mast4 APN 13 102737615 missense probably damaging 0.98
IGL01738:Mast4 APN 13 102737241 missense probably damaging 1.00
IGL01739:Mast4 APN 13 102774273 missense probably damaging 1.00
IGL02299:Mast4 APN 13 102737974 missense probably benign 0.44
IGL02479:Mast4 APN 13 102742037 missense probably damaging 1.00
IGL02485:Mast4 APN 13 102735496 missense probably benign 0.02
IGL02528:Mast4 APN 13 102853823 makesense probably null
IGL02850:Mast4 APN 13 102754232 missense probably damaging 1.00
IGL02900:Mast4 APN 13 102735676 missense probably benign
IGL03064:Mast4 APN 13 102760964 nonsense probably null
IGL03124:Mast4 APN 13 102738245 missense probably damaging 1.00
IGL03146:Mast4 APN 13 102737655 missense probably benign 0.00
IGL03221:Mast4 APN 13 102754256 missense possibly damaging 0.95
IGL03284:Mast4 APN 13 102751397 missense probably damaging 1.00
IGL03406:Mast4 APN 13 102737107 missense possibly damaging 0.46
buck UTSW 13 102761293 critical splice donor site probably null
doe UTSW 13 102905677 missense possibly damaging 0.85
skinnybones UTSW 13 102804641 critical splice donor site probably null
BB010:Mast4 UTSW 13 102772563 missense probably damaging 0.99
BB020:Mast4 UTSW 13 102772563 missense probably damaging 0.99
FR4304:Mast4 UTSW 13 102734862 utr 3 prime probably benign
FR4340:Mast4 UTSW 13 102734857 frame shift probably null
FR4340:Mast4 UTSW 13 102736317 small insertion probably benign
FR4548:Mast4 UTSW 13 102736318 small insertion probably benign
FR4976:Mast4 UTSW 13 102736312 small insertion probably benign
FR4976:Mast4 UTSW 13 102739247 frame shift probably null
NA:Mast4 UTSW 13 102742057 missense probably damaging 1.00
PIT4466001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4469001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
PIT4472001:Mast4 UTSW 13 102804718 missense probably damaging 1.00
R0009:Mast4 UTSW 13 102742058 missense probably damaging 1.00
R0063:Mast4 UTSW 13 103334215 start gained probably benign
R0242:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R0310:Mast4 UTSW 13 102754161 missense possibly damaging 0.94
R0395:Mast4 UTSW 13 102735273 missense probably damaging 1.00
R0454:Mast4 UTSW 13 102751560 missense probably damaging 1.00
R0646:Mast4 UTSW 13 102758744 splice site probably benign
R0744:Mast4 UTSW 13 102737387 missense probably damaging 0.98
R0883:Mast4 UTSW 13 102853900 missense probably damaging 1.00
R0905:Mast4 UTSW 13 102770784 missense probably damaging 0.99
R1023:Mast4 UTSW 13 102735496 missense probably benign 0.02
R1281:Mast4 UTSW 13 102750578 missense probably damaging 1.00
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1376:Mast4 UTSW 13 102736408 missense possibly damaging 0.46
R1473:Mast4 UTSW 13 102772519 missense probably damaging 1.00
R1572:Mast4 UTSW 13 102736923 missense possibly damaging 0.51
R1575:Mast4 UTSW 13 102739263 missense probably damaging 1.00
R1865:Mast4 UTSW 13 102794117 missense probably damaging 1.00
R2050:Mast4 UTSW 13 102751409 missense probably damaging 1.00
R2060:Mast4 UTSW 13 102738846 missense probably damaging 1.00
R2062:Mast4 UTSW 13 102759093 missense probably benign 0.18
R2106:Mast4 UTSW 13 102750546 missense probably damaging 1.00
R2118:Mast4 UTSW 13 102754205 missense probably damaging 1.00
R2143:Mast4 UTSW 13 102735475 missense possibly damaging 0.89
R2256:Mast4 UTSW 13 102735751 missense possibly damaging 0.62
R2261:Mast4 UTSW 13 102798207 splice site probably benign
R2370:Mast4 UTSW 13 102774187 missense probably damaging 1.00
R2504:Mast4 UTSW 13 102738639 missense probably damaging 0.96
R2509:Mast4 UTSW 13 102853842 missense probably damaging 1.00
R2842:Mast4 UTSW 13 102736431 missense probably benign 0.01
R3087:Mast4 UTSW 13 102853926 splice site probably benign
R3434:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3435:Mast4 UTSW 13 102787379 missense probably damaging 1.00
R3763:Mast4 UTSW 13 102787419 missense probably damaging 1.00
R3826:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3829:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3830:Mast4 UTSW 13 102738811 missense probably damaging 1.00
R3913:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R3914:Mast4 UTSW 13 102739321 nonsense probably null
R4021:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102739321 nonsense probably null
R4022:Mast4 UTSW 13 102853869 missense probably damaging 1.00
R4210:Mast4 UTSW 13 102739205 missense probably damaging 1.00
R4342:Mast4 UTSW 13 102774248 missense probably damaging 1.00
R4580:Mast4 UTSW 13 102737258 nonsense probably null
R4627:Mast4 UTSW 13 103334021 missense possibly damaging 0.92
R4711:Mast4 UTSW 13 103334119 missense probably benign 0.01
R4732:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4733:Mast4 UTSW 13 102772572 missense probably damaging 0.99
R4833:Mast4 UTSW 13 102774184 critical splice donor site probably null
R4995:Mast4 UTSW 13 102905754 intron probably benign
R5059:Mast4 UTSW 13 102750563 missense probably damaging 1.00
R5073:Mast4 UTSW 13 102738883 nonsense probably null
R5101:Mast4 UTSW 13 102736356 missense probably benign 0.01
R5526:Mast4 UTSW 13 102754215 missense possibly damaging 0.48
R5599:Mast4 UTSW 13 102737479 missense probably damaging 1.00
R5673:Mast4 UTSW 13 102794072 missense probably damaging 1.00
R5694:Mast4 UTSW 13 102774193 nonsense probably null
R5906:Mast4 UTSW 13 102735744 missense probably benign 0.31
R5908:Mast4 UTSW 13 102738256 missense probably damaging 1.00
R5947:Mast4 UTSW 13 102735640 missense probably benign
R5987:Mast4 UTSW 13 102758734 missense probably damaging 1.00
R6143:Mast4 UTSW 13 102853883 missense probably damaging 1.00
R6154:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6169:Mast4 UTSW 13 102787421 missense probably damaging 1.00
R6239:Mast4 UTSW 13 102736209 missense probably benign 0.01
R6327:Mast4 UTSW 13 102761382 missense probably damaging 1.00
R6356:Mast4 UTSW 13 102735985 missense possibly damaging 0.80
R6432:Mast4 UTSW 13 102905677 missense possibly damaging 0.85
R6522:Mast4 UTSW 13 102761293 critical splice donor site probably null
R6667:Mast4 UTSW 13 102737496 missense probably damaging 1.00
R6941:Mast4 UTSW 13 102804714 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102798078 missense probably damaging 1.00
R6968:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6970:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6980:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6991:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6992:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R6993:Mast4 UTSW 13 102735974 missense probably benign 0.28
R6993:Mast4 UTSW 13 102804647 missense probably damaging 1.00
R7083:Mast4 UTSW 13 102737715 missense probably damaging 1.00
R7241:Mast4 UTSW 13 103334000 missense possibly damaging 0.87
R7242:Mast4 UTSW 13 102738478 missense probably damaging 1.00
R7246:Mast4 UTSW 13 102794003 missense probably damaging 1.00
R7332:Mast4 UTSW 13 102751424 missense possibly damaging 0.61
R7514:Mast4 UTSW 13 102787426 nonsense probably null
R7697:Mast4 UTSW 13 102739203 missense probably damaging 1.00
R7820:Mast4 UTSW 13 102754088 missense probably damaging 1.00
R7874:Mast4 UTSW 13 102739275 missense probably damaging 1.00
R7933:Mast4 UTSW 13 102772563 missense probably damaging 0.99
R8042:Mast4 UTSW 13 102781245 missense probably damaging 0.96
R8060:Mast4 UTSW 13 102737676 missense possibly damaging 0.89
R8172:Mast4 UTSW 13 102953125 critical splice donor site probably null
R8206:Mast4 UTSW 13 102735739 missense probably damaging 1.00
R8248:Mast4 UTSW 13 102738721 missense probably damaging 1.00
R8283:Mast4 UTSW 13 102758669 missense probably damaging 1.00
R8346:Mast4 UTSW 13 102751478 missense probably damaging 0.99
R8434:Mast4 UTSW 13 102761392 missense probably damaging 1.00
RF005:Mast4 UTSW 13 102736307 small insertion probably benign
RF015:Mast4 UTSW 13 102739247 frame shift probably null
RF019:Mast4 UTSW 13 102736307 small insertion probably benign
RF037:Mast4 UTSW 13 102739241 small deletion probably benign
RF039:Mast4 UTSW 13 102739241 small deletion probably benign
RF040:Mast4 UTSW 13 102739241 small deletion probably benign
Z1088:Mast4 UTSW 13 102738519 missense probably damaging 1.00
Z1176:Mast4 UTSW 13 102738460 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCCAGAAACTGTACCATTTCTAC -3'
(R):5'- TGTTTACCCTAACCCAGGCC -3'

Sequencing Primer
(F):5'- CATTGTTAGGCCATTGTTTGACAC -3'
(R):5'- GCATTCTCACATCCTCATAGACTATG -3'
Posted On2019-10-07