Incidental Mutation 'R7454:Hmcn1'
ID 577956
Institutional Source Beutler Lab
Gene Symbol Hmcn1
Ensembl Gene ENSMUSG00000066842
Gene Name hemicentin 1
Synonyms LOC240793, EG545370
MMRRC Submission 045528-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7454 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 150562524-150993435 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 150563604 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 5610 (S5610P)
Ref Sequence ENSEMBL: ENSMUSP00000074340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074783] [ENSMUST00000137197] [ENSMUST00000177036]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000074783
AA Change: S5610P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000074340
Gene: ENSMUSG00000066842
AA Change: S5610P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
Pfam:G2F 4869 5051 1.5e-57 PFAM
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5354 4.32e-10 SMART
low complexity region 5384 5400 N/A INTRINSIC
low complexity region 5401 5412 N/A INTRINSIC
EGF_CA 5431 5470 2.78e-13 SMART
EGF 5474 5516 1.44e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137197
AA Change: S5493P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121500
Gene: ENSMUSG00000066842
AA Change: S5493P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 39 213 3e-1 SMART
IG_like 445 506 1.13e0 SMART
IGc2 532 598 2.32e-8 SMART
IGc2 624 688 1.24e-8 SMART
IGc2 714 779 7.52e-8 SMART
IGc2 805 874 2.19e-9 SMART
IGc2 902 967 5.15e-15 SMART
IGc2 993 1058 1.28e-10 SMART
IGc2 1092 1157 1.69e-10 SMART
IGc2 1183 1247 1.09e-13 SMART
IGc2 1278 1344 6.49e-12 SMART
IGc2 1372 1437 5.2e-11 SMART
IGc2 1465 1531 1.34e-13 SMART
IGc2 1559 1624 6.25e-14 SMART
IGc2 1653 1718 4.06e-13 SMART
IGc2 1746 1811 4.12e-14 SMART
IGc2 1838 1904 5.92e-15 SMART
IGc2 1932 1997 7.69e-14 SMART
IGc2 2023 2089 3.3e-13 SMART
IGc2 2115 2180 5e-13 SMART
IGc2 2208 2275 1.32e-12 SMART
IGc2 2304 2369 2.91e-14 SMART
IGc2 2398 2463 4e-12 SMART
IGc2 2491 2556 1.94e-19 SMART
IGc2 2587 2652 2.54e-14 SMART
IGc2 2686 2751 7.57e-13 SMART
IGc2 2789 2854 4.88e-16 SMART
IGc2 2884 2949 2.7e-9 SMART
IGc2 2976 3041 1.47e-10 SMART
IGc2 3071 3136 2.24e-15 SMART
IGc2 3163 3230 8.83e-14 SMART
IGc2 3258 3325 9.76e-16 SMART
IGc2 3354 3419 1.54e-13 SMART
IGc2 3447 3512 4.35e-13 SMART
IGc2 3540 3605 2e-12 SMART
IGc2 3633 3698 7.69e-14 SMART
IGc2 3724 3789 1.92e-14 SMART
IGc2 3815 3882 2.58e-6 SMART
IGc2 3908 3973 6.4e-11 SMART
IGc2 3999 4064 2.78e-11 SMART
IGc2 4090 4154 1.74e-12 SMART
low complexity region 4155 4160 N/A INTRINSIC
IGc2 4180 4245 3.35e-14 SMART
IGc2 4271 4334 8.12e-13 SMART
IGc2 4361 4425 1.79e-14 SMART
IGc2 4451 4515 1.06e-11 SMART
TSP1 4531 4583 4.72e-15 SMART
TSP1 4588 4640 2.39e-16 SMART
TSP1 4645 4697 1.67e-15 SMART
TSP1 4702 4754 2.2e-15 SMART
TSP1 4759 4811 2.77e-12 SMART
TSP1 4816 4868 2.67e-14 SMART
PDB:1GL4|A 4869 5082 3e-6 PDB
SCOP:d1gl4a1 4869 5082 3e-79 SMART
EGF_CA 5106 5145 4.38e-11 SMART
EGF_CA 5146 5190 4.49e-8 SMART
EGF_CA 5191 5228 2.38e-12 SMART
EGF_CA 5229 5270 6.8e-8 SMART
EGF_CA 5271 5313 3.51e-10 SMART
EGF_CA 5314 5353 2.78e-13 SMART
EGF 5357 5399 1.44e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177036
SMART Domains Protein: ENSMUSP00000134985
Gene: ENSMUSG00000066842

DomainStartEndE-ValueType
EGF_CA 16 57 6.8e-8 SMART
EGF_CA 58 100 3.51e-10 SMART
EGF_CA 101 140 2.78e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large extracellular member of the immunoglobulin superfamily. A similar protein in C. elegans forms long, fine tracks at specific extracellular sites that are involved in many processes such as stabilization of the germline syncytium, anchorage of mechanosensory neurons to the epidermis, and organization of hemidesmosomes in the epidermis. Mutations in this gene may be associated with age-related macular degeneration. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510002D24Rik A G 16: 18,836,851 (GRCm38) E57G possibly damaging Het
4932414N04Rik C A 2: 68,688,304 (GRCm38) T159K unknown Het
Adamts10 T A 17: 33,545,005 (GRCm38) F616L possibly damaging Het
Adtrp G A 13: 41,828,315 (GRCm38) S26L unknown Het
Alpk3 A C 7: 81,078,562 (GRCm38) E480A probably benign Het
Anks6 T C 4: 47,038,919 (GRCm38) T529A unknown Het
Arl4d A G 11: 101,666,660 (GRCm38) H4R probably benign Het
Ash1l A G 3: 88,983,865 (GRCm38) H1017R probably benign Het
Bbs12 T C 3: 37,320,953 (GRCm38) S517P possibly damaging Het
Bcl11b C A 12: 107,916,208 (GRCm38) R616L possibly damaging Het
Bean1 G A 8: 104,211,026 (GRCm38) G79D probably damaging Het
Bicra C G 7: 15,972,134 (GRCm38) G1461R probably benign Het
Bptf T C 11: 107,044,640 (GRCm38) T124A probably benign Het
Btnl4 A T 17: 34,472,374 (GRCm38) V312E probably benign Het
Ccdc7a A G 8: 128,944,516 (GRCm38) M503T unknown Het
Celf5 T C 10: 81,482,523 (GRCm38) E28G probably damaging Het
Cilp2 G A 8: 69,883,390 (GRCm38) L350F probably damaging Het
Clec4a2 T C 6: 123,142,452 (GRCm38) I245T probably damaging Het
Ctnnal1 A T 4: 56,844,544 (GRCm38) V140D probably damaging Het
Dennd4a A C 9: 64,852,570 (GRCm38) H319P probably damaging Het
Dlgap3 G T 4: 127,235,059 (GRCm38) L857F probably null Het
Dnah6 T A 6: 73,212,492 (GRCm38) T58S probably damaging Het
Dnah7a T A 1: 53,518,764 (GRCm38) M2164L probably benign Het
Dspp T A 5: 104,175,610 (GRCm38) H206Q probably benign Het
Dzip1l G A 9: 99,659,674 (GRCm38) V443M possibly damaging Het
Erc2 A G 14: 28,302,991 (GRCm38) H939R possibly damaging Het
Fam149a G T 8: 45,348,546 (GRCm38) H513N probably benign Het
Fam171a2 T C 11: 102,439,717 (GRCm38) T280A possibly damaging Het
Fkbp5 A C 17: 28,416,025 (GRCm38) V170G probably damaging Het
Fnbp4 ACCACCTCCACCTCCACCTCC ACCACCTCCACCTCCACCTCCACCTCC 2: 90,777,815 (GRCm38) probably benign Het
Fzd2 T C 11: 102,605,129 (GRCm38) F133S probably damaging Het
Galm A G 17: 80,138,121 (GRCm38) N100S possibly damaging Het
Gbp2b T A 3: 142,598,159 (GRCm38) I5N possibly damaging Het
Gga2 T C 7: 122,002,146 (GRCm38) R245G probably benign Het
Gm10053 A G 19: 24,875,900 (GRCm38) T50A probably benign Het
Gm1110 T C 9: 26,920,649 (GRCm38) T69A probably benign Het
Gm15922 T G 7: 3,735,510 (GRCm38) E622D probably benign Het
Heatr5a T C 12: 51,961,543 (GRCm38) S6G probably benign Het
Hmgb4 A G 4: 128,260,406 (GRCm38) V123A probably damaging Het
Itgal C A 7: 127,327,764 (GRCm38) Q943K probably benign Het
Jakmip1 C A 5: 37,175,154 (GRCm38) D1059E probably damaging Het
Jazf1 T C 6: 52,893,944 (GRCm38) probably null Het
Kat6a A G 8: 22,935,772 (GRCm38) E1111G possibly damaging Het
Kdm4b C A 17: 56,389,639 (GRCm38) P452T probably benign Het
Krit1 T C 5: 3,812,474 (GRCm38) Y210H probably damaging Het
Krtap6-2 A T 16: 89,419,912 (GRCm38) Y56N unknown Het
Lig1 A T 7: 13,288,721 (GRCm38) D158V probably damaging Het
Lmo1 A T 7: 109,140,666 (GRCm38) L94Q probably benign Het
Lrrc30 A T 17: 67,632,243 (GRCm38) L114H probably damaging Het
Ltn1 T C 16: 87,397,812 (GRCm38) I1400V probably benign Het
Mark3 T C 12: 111,604,527 (GRCm38) I87T probably damaging Het
Mfrp G T 9: 44,105,183 (GRCm38) V392F possibly damaging Het
Mrgprg A G 7: 143,765,135 (GRCm38) L80P probably damaging Het
Ndufaf3 A T 9: 108,566,926 (GRCm38) M1K probably null Het
Nme7 T A 1: 164,380,648 (GRCm38) L295* probably null Het
Noct G T 3: 51,249,730 (GRCm38) C163F probably damaging Het
Or11h4b T A 14: 50,680,824 (GRCm38) Q270L possibly damaging Het
Or13a26 A T 7: 140,704,634 (GRCm38) I128F probably damaging Het
Or4b1 T A 2: 90,149,419 (GRCm38) I196F possibly damaging Het
Or5ak22 T A 2: 85,399,611 (GRCm38) K307N probably damaging Het
Or6c203 T A 10: 129,174,455 (GRCm38) T189S probably damaging Het
Or8g2 A G 9: 39,909,904 (GRCm38) I34V probably benign Het
Patz1 C T 11: 3,298,297 (GRCm38) probably benign Het
Per3 A G 4: 151,012,728 (GRCm38) L780P probably benign Het
Pla2g4a T C 1: 149,872,690 (GRCm38) M256V possibly damaging Het
Pnliprp1 A G 19: 58,741,100 (GRCm38) K395R probably benign Het
Poc5 G T 13: 96,400,832 (GRCm38) G242V possibly damaging Het
Ppfia4 A G 1: 134,324,135 (GRCm38) S434P possibly damaging Het
Prss42 A G 9: 110,798,829 (GRCm38) N110S probably benign Het
Ralgapb T A 2: 158,432,902 (GRCm38) I241N possibly damaging Het
Rbak A C 5: 143,173,773 (GRCm38) Y508* probably null Het
S1pr2 G T 9: 20,967,549 (GRCm38) R328S possibly damaging Het
Sap130 T C 18: 31,650,512 (GRCm38) M214T probably benign Het
Slc46a1 T A 11: 78,466,511 (GRCm38) V130E probably damaging Het
Smc4 A T 3: 69,018,124 (GRCm38) H343L probably benign Het
Tarbp1 C A 8: 126,457,677 (GRCm38) R500L probably benign Het
Tasor2 A G 13: 3,585,332 (GRCm38) S492P probably benign Het
Tgfbr3 A T 5: 107,215,028 (GRCm38) H39Q probably damaging Het
Tpp2 T C 1: 43,954,659 (GRCm38) S235P probably benign Het
Trbc2 G T 6: 41,546,829 (GRCm38) R33M Het
Trim3 C T 7: 105,619,558 (GRCm38) R63Q probably damaging Het
Ttc28 T C 5: 111,285,484 (GRCm38) V2128A probably benign Het
Ttn T A 2: 76,944,139 (GRCm38) Q2187L unknown Het
Ttn C T 2: 76,725,818 (GRCm38) R30281H probably damaging Het
Ttyh3 T C 5: 140,629,425 (GRCm38) S403G possibly damaging Het
Vmn2r112 A T 17: 22,603,307 (GRCm38) D322V probably benign Het
Wdr38 C T 2: 38,998,340 (GRCm38) probably benign Het
Xrn1 T A 9: 96,048,358 (GRCm38) S1543R probably benign Het
Zbtb8b G A 4: 129,432,769 (GRCm38) T201I possibly damaging Het
Other mutations in Hmcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Hmcn1 APN 1 150,677,278 (GRCm38) missense probably benign
IGL00571:Hmcn1 APN 1 150,638,999 (GRCm38) missense probably benign 0.05
IGL00726:Hmcn1 APN 1 150,806,366 (GRCm38) critical splice donor site probably null
IGL00802:Hmcn1 APN 1 150,664,936 (GRCm38) missense probably benign 0.19
IGL00824:Hmcn1 APN 1 150,656,734 (GRCm38) missense probably damaging 1.00
IGL00834:Hmcn1 APN 1 150,630,340 (GRCm38) missense probably benign 0.00
IGL00843:Hmcn1 APN 1 150,610,713 (GRCm38) missense possibly damaging 0.95
IGL00845:Hmcn1 APN 1 150,605,006 (GRCm38) missense probably damaging 0.98
IGL00851:Hmcn1 APN 1 150,582,301 (GRCm38) missense probably benign 0.02
IGL00909:Hmcn1 APN 1 150,638,869 (GRCm38) missense probably benign 0.12
IGL01074:Hmcn1 APN 1 150,627,033 (GRCm38) missense possibly damaging 0.82
IGL01112:Hmcn1 APN 1 150,632,552 (GRCm38) splice site probably benign
IGL01304:Hmcn1 APN 1 150,622,924 (GRCm38) missense probably damaging 0.99
IGL01307:Hmcn1 APN 1 150,745,001 (GRCm38) missense possibly damaging 0.84
IGL01318:Hmcn1 APN 1 150,719,240 (GRCm38) missense probably damaging 1.00
IGL01403:Hmcn1 APN 1 150,593,097 (GRCm38) missense probably damaging 1.00
IGL01417:Hmcn1 APN 1 150,859,239 (GRCm38) missense probably damaging 1.00
IGL01503:Hmcn1 APN 1 150,605,072 (GRCm38) missense probably benign 0.38
IGL01509:Hmcn1 APN 1 150,609,631 (GRCm38) missense probably damaging 1.00
IGL01550:Hmcn1 APN 1 150,598,397 (GRCm38) missense probably damaging 1.00
IGL01601:Hmcn1 APN 1 150,627,413 (GRCm38) missense probably benign 0.01
IGL01617:Hmcn1 APN 1 150,672,032 (GRCm38) missense probably benign 0.05
IGL01636:Hmcn1 APN 1 150,580,233 (GRCm38) missense probably damaging 1.00
IGL01662:Hmcn1 APN 1 150,737,299 (GRCm38) missense possibly damaging 0.46
IGL01693:Hmcn1 APN 1 150,583,280 (GRCm38) missense probably damaging 1.00
IGL01723:Hmcn1 APN 1 150,744,960 (GRCm38) missense probably benign 0.01
IGL01776:Hmcn1 APN 1 150,672,038 (GRCm38) missense possibly damaging 0.70
IGL01783:Hmcn1 APN 1 150,615,300 (GRCm38) missense possibly damaging 0.60
IGL01789:Hmcn1 APN 1 150,690,601 (GRCm38) missense probably damaging 1.00
IGL01900:Hmcn1 APN 1 150,742,260 (GRCm38) splice site probably benign
IGL01906:Hmcn1 APN 1 150,667,887 (GRCm38) missense probably benign 0.01
IGL01947:Hmcn1 APN 1 150,732,892 (GRCm38) missense possibly damaging 0.93
IGL01958:Hmcn1 APN 1 150,603,871 (GRCm38) missense probably benign 0.01
IGL02002:Hmcn1 APN 1 150,615,298 (GRCm38) missense probably damaging 1.00
IGL02058:Hmcn1 APN 1 150,704,181 (GRCm38) missense probably benign 0.02
IGL02115:Hmcn1 APN 1 150,630,728 (GRCm38) missense probably damaging 1.00
IGL02127:Hmcn1 APN 1 150,722,607 (GRCm38) missense probably benign
IGL02155:Hmcn1 APN 1 150,563,598 (GRCm38) missense probably damaging 1.00
IGL02222:Hmcn1 APN 1 150,806,401 (GRCm38) missense probably benign 0.05
IGL02293:Hmcn1 APN 1 150,664,915 (GRCm38) missense probably damaging 0.97
IGL02398:Hmcn1 APN 1 150,802,897 (GRCm38) missense possibly damaging 0.78
IGL02420:Hmcn1 APN 1 150,722,424 (GRCm38) missense probably damaging 1.00
IGL02553:Hmcn1 APN 1 150,993,023 (GRCm38) missense probably benign 0.12
IGL02561:Hmcn1 APN 1 150,809,726 (GRCm38) missense probably benign 0.32
IGL02569:Hmcn1 APN 1 150,697,493 (GRCm38) missense probably benign 0.01
IGL02607:Hmcn1 APN 1 150,744,995 (GRCm38) missense possibly damaging 0.88
IGL02676:Hmcn1 APN 1 150,619,009 (GRCm38) missense probably benign 0.01
IGL02725:Hmcn1 APN 1 150,604,903 (GRCm38) missense possibly damaging 0.92
IGL02726:Hmcn1 APN 1 150,656,694 (GRCm38) nonsense probably null
IGL02735:Hmcn1 APN 1 150,646,832 (GRCm38) missense probably benign 0.02
IGL02737:Hmcn1 APN 1 150,563,828 (GRCm38) missense probably damaging 1.00
IGL02892:Hmcn1 APN 1 150,675,974 (GRCm38) critical splice donor site probably null
IGL02927:Hmcn1 APN 1 150,577,278 (GRCm38) missense probably damaging 1.00
IGL02931:Hmcn1 APN 1 150,657,207 (GRCm38) missense probably benign 0.37
IGL02936:Hmcn1 APN 1 150,697,522 (GRCm38) missense probably damaging 0.98
IGL02985:Hmcn1 APN 1 150,671,917 (GRCm38) missense probably damaging 1.00
IGL03027:Hmcn1 APN 1 150,808,539 (GRCm38) missense probably benign
IGL03195:Hmcn1 APN 1 150,802,909 (GRCm38) missense probably benign 0.06
IGL03217:Hmcn1 APN 1 150,743,667 (GRCm38) missense possibly damaging 0.58
IGL03232:Hmcn1 APN 1 150,770,352 (GRCm38) splice site probably benign
IGL03268:Hmcn1 APN 1 150,772,510 (GRCm38) missense probably damaging 1.00
IGL03271:Hmcn1 APN 1 150,598,424 (GRCm38) missense possibly damaging 0.92
IGL03304:Hmcn1 APN 1 150,630,231 (GRCm38) missense probably damaging 0.97
IGL03329:Hmcn1 APN 1 150,732,910 (GRCm38) missense probably damaging 1.00
IGL03339:Hmcn1 APN 1 150,701,969 (GRCm38) missense probably benign 0.04
IGL03368:Hmcn1 APN 1 150,663,872 (GRCm38) missense probably damaging 1.00
Backbone UTSW 1 150,622,994 (GRCm38) missense probably benign 0.09
Cambrian UTSW 1 150,732,846 (GRCm38) missense probably damaging 1.00
chordate UTSW 1 150,587,015 (GRCm38) missense probably benign 0.00
Justamere UTSW 1 150,588,257 (GRCm38) missense probably damaging 1.00
Lancelet UTSW 1 150,675,540 (GRCm38) missense probably benign 0.00
notochord UTSW 1 150,770,293 (GRCm38) missense probably benign 0.00
wippoorwill UTSW 1 150,732,946 (GRCm38) missense probably damaging 1.00
BB004:Hmcn1 UTSW 1 150,609,775 (GRCm38) missense probably damaging 1.00
BB014:Hmcn1 UTSW 1 150,609,775 (GRCm38) missense probably damaging 1.00
IGL02991:Hmcn1 UTSW 1 150,738,658 (GRCm38) missense possibly damaging 0.56
P0017:Hmcn1 UTSW 1 150,720,689 (GRCm38) missense possibly damaging 0.49
PIT1430001:Hmcn1 UTSW 1 150,808,737 (GRCm38) missense probably benign 0.00
PIT4514001:Hmcn1 UTSW 1 150,669,487 (GRCm38) missense possibly damaging 0.93
R0006:Hmcn1 UTSW 1 150,808,676 (GRCm38) missense probably damaging 0.99
R0018:Hmcn1 UTSW 1 150,652,551 (GRCm38) missense probably benign 0.16
R0052:Hmcn1 UTSW 1 150,677,406 (GRCm38) missense probably damaging 1.00
R0107:Hmcn1 UTSW 1 150,587,015 (GRCm38) missense probably benign 0.00
R0115:Hmcn1 UTSW 1 150,808,647 (GRCm38) missense possibly damaging 0.88
R0149:Hmcn1 UTSW 1 150,677,324 (GRCm38) missense probably benign 0.00
R0152:Hmcn1 UTSW 1 150,663,879 (GRCm38) missense probably benign 0.01
R0381:Hmcn1 UTSW 1 150,603,811 (GRCm38) missense probably damaging 1.00
R0398:Hmcn1 UTSW 1 150,798,814 (GRCm38) missense possibly damaging 0.83
R0414:Hmcn1 UTSW 1 150,715,822 (GRCm38) missense possibly damaging 0.72
R0494:Hmcn1 UTSW 1 150,732,792 (GRCm38) splice site probably benign
R0503:Hmcn1 UTSW 1 150,859,252 (GRCm38) missense probably damaging 1.00
R0504:Hmcn1 UTSW 1 150,876,419 (GRCm38) splice site probably benign
R0506:Hmcn1 UTSW 1 150,742,341 (GRCm38) missense possibly damaging 0.69
R0554:Hmcn1 UTSW 1 150,719,117 (GRCm38) missense probably benign 0.34
R0576:Hmcn1 UTSW 1 150,650,017 (GRCm38) nonsense probably null
R0599:Hmcn1 UTSW 1 150,609,801 (GRCm38) missense possibly damaging 0.91
R0605:Hmcn1 UTSW 1 150,657,376 (GRCm38) critical splice donor site probably null
R0607:Hmcn1 UTSW 1 150,638,900 (GRCm38) missense probably benign 0.01
R0620:Hmcn1 UTSW 1 150,594,016 (GRCm38) missense probably benign 0.04
R0626:Hmcn1 UTSW 1 150,798,719 (GRCm38) splice site probably null
R0699:Hmcn1 UTSW 1 150,819,410 (GRCm38) missense probably damaging 1.00
R0765:Hmcn1 UTSW 1 150,808,787 (GRCm38) missense probably damaging 1.00
R0782:Hmcn1 UTSW 1 150,753,665 (GRCm38) missense possibly damaging 0.82
R0783:Hmcn1 UTSW 1 150,650,073 (GRCm38) missense probably damaging 1.00
R0841:Hmcn1 UTSW 1 150,679,607 (GRCm38) splice site probably null
R0975:Hmcn1 UTSW 1 150,577,377 (GRCm38) missense probably benign 0.00
R1070:Hmcn1 UTSW 1 150,689,590 (GRCm38) missense probably damaging 0.98
R1118:Hmcn1 UTSW 1 150,618,928 (GRCm38) missense possibly damaging 0.56
R1119:Hmcn1 UTSW 1 150,618,928 (GRCm38) missense possibly damaging 0.56
R1145:Hmcn1 UTSW 1 150,679,607 (GRCm38) splice site probably null
R1145:Hmcn1 UTSW 1 150,679,607 (GRCm38) splice site probably null
R1233:Hmcn1 UTSW 1 150,749,026 (GRCm38) missense probably benign
R1234:Hmcn1 UTSW 1 150,753,654 (GRCm38) nonsense probably null
R1291:Hmcn1 UTSW 1 150,748,191 (GRCm38) missense probably damaging 1.00
R1334:Hmcn1 UTSW 1 150,586,468 (GRCm38) missense possibly damaging 0.73
R1372:Hmcn1 UTSW 1 150,680,715 (GRCm38) missense probably benign 0.22
R1424:Hmcn1 UTSW 1 150,646,794 (GRCm38) missense probably benign 0.00
R1450:Hmcn1 UTSW 1 150,652,506 (GRCm38) splice site probably benign
R1458:Hmcn1 UTSW 1 150,609,700 (GRCm38) missense probably damaging 1.00
R1467:Hmcn1 UTSW 1 150,689,590 (GRCm38) missense probably damaging 0.98
R1467:Hmcn1 UTSW 1 150,689,590 (GRCm38) missense probably damaging 0.98
R1473:Hmcn1 UTSW 1 150,772,552 (GRCm38) missense probably benign 0.03
R1517:Hmcn1 UTSW 1 150,669,421 (GRCm38) missense probably damaging 1.00
R1527:Hmcn1 UTSW 1 150,773,803 (GRCm38) missense probably benign 0.00
R1557:Hmcn1 UTSW 1 150,734,532 (GRCm38) missense possibly damaging 0.86
R1576:Hmcn1 UTSW 1 150,657,241 (GRCm38) missense possibly damaging 0.77
R1617:Hmcn1 UTSW 1 150,745,027 (GRCm38) missense probably damaging 0.98
R1635:Hmcn1 UTSW 1 150,669,558 (GRCm38) missense probably benign 0.00
R1655:Hmcn1 UTSW 1 150,630,333 (GRCm38) missense probably benign 0.03
R1698:Hmcn1 UTSW 1 150,565,369 (GRCm38) nonsense probably null
R1710:Hmcn1 UTSW 1 150,675,984 (GRCm38) missense probably damaging 1.00
R1717:Hmcn1 UTSW 1 150,859,186 (GRCm38) missense probably damaging 1.00
R1753:Hmcn1 UTSW 1 150,586,468 (GRCm38) missense possibly damaging 0.73
R1756:Hmcn1 UTSW 1 150,599,030 (GRCm38) missense probably damaging 1.00
R1772:Hmcn1 UTSW 1 150,563,568 (GRCm38) missense probably damaging 0.99
R1793:Hmcn1 UTSW 1 150,749,083 (GRCm38) missense probably benign 0.01
R1794:Hmcn1 UTSW 1 150,627,152 (GRCm38) missense probably damaging 0.98
R1794:Hmcn1 UTSW 1 150,598,285 (GRCm38) missense probably benign 0.00
R1856:Hmcn1 UTSW 1 150,721,664 (GRCm38) missense probably benign 0.02
R1859:Hmcn1 UTSW 1 150,657,193 (GRCm38) missense probably damaging 1.00
R1862:Hmcn1 UTSW 1 150,638,900 (GRCm38) missense probably benign 0.01
R1865:Hmcn1 UTSW 1 150,603,812 (GRCm38) missense probably damaging 1.00
R1874:Hmcn1 UTSW 1 150,720,695 (GRCm38) missense probably damaging 1.00
R1880:Hmcn1 UTSW 1 150,638,900 (GRCm38) missense probably benign 0.01
R1881:Hmcn1 UTSW 1 150,638,900 (GRCm38) missense probably benign 0.01
R1886:Hmcn1 UTSW 1 150,577,295 (GRCm38) missense probably benign 0.02
R1888:Hmcn1 UTSW 1 150,819,500 (GRCm38) missense possibly damaging 0.82
R1888:Hmcn1 UTSW 1 150,819,500 (GRCm38) missense possibly damaging 0.82
R1899:Hmcn1 UTSW 1 150,657,451 (GRCm38) missense probably damaging 1.00
R1905:Hmcn1 UTSW 1 150,992,855 (GRCm38) missense probably damaging 1.00
R1912:Hmcn1 UTSW 1 150,604,882 (GRCm38) missense probably benign 0.28
R1959:Hmcn1 UTSW 1 150,649,676 (GRCm38) missense probably benign 0.00
R1960:Hmcn1 UTSW 1 150,677,376 (GRCm38) missense possibly damaging 0.72
R1960:Hmcn1 UTSW 1 150,675,991 (GRCm38) missense probably benign 0.00
R2001:Hmcn1 UTSW 1 150,738,613 (GRCm38) missense possibly damaging 0.81
R2011:Hmcn1 UTSW 1 150,677,334 (GRCm38) missense probably benign 0.01
R2075:Hmcn1 UTSW 1 150,577,323 (GRCm38) missense possibly damaging 0.86
R2136:Hmcn1 UTSW 1 150,633,659 (GRCm38) missense probably damaging 1.00
R2192:Hmcn1 UTSW 1 150,715,815 (GRCm38) missense probably damaging 0.97
R2267:Hmcn1 UTSW 1 150,599,010 (GRCm38) missense probably benign 0.00
R2268:Hmcn1 UTSW 1 150,624,598 (GRCm38) splice site probably benign
R2303:Hmcn1 UTSW 1 150,704,226 (GRCm38) missense probably damaging 1.00
R2330:Hmcn1 UTSW 1 150,652,678 (GRCm38) splice site probably benign
R2338:Hmcn1 UTSW 1 150,622,934 (GRCm38) missense possibly damaging 0.89
R2380:Hmcn1 UTSW 1 150,565,384 (GRCm38) missense probably benign 0.01
R2405:Hmcn1 UTSW 1 150,860,341 (GRCm38) missense probably damaging 1.00
R2443:Hmcn1 UTSW 1 150,599,032 (GRCm38) missense probably benign 0.01
R2496:Hmcn1 UTSW 1 150,615,221 (GRCm38) missense probably benign 0.01
R2504:Hmcn1 UTSW 1 150,686,867 (GRCm38) nonsense probably null
R2519:Hmcn1 UTSW 1 150,773,820 (GRCm38) nonsense probably null
R2520:Hmcn1 UTSW 1 150,743,647 (GRCm38) missense possibly damaging 0.72
R2679:Hmcn1 UTSW 1 150,652,575 (GRCm38) missense possibly damaging 0.67
R2831:Hmcn1 UTSW 1 150,630,652 (GRCm38) critical splice donor site probably null
R2847:Hmcn1 UTSW 1 150,563,599 (GRCm38) nonsense probably null
R2849:Hmcn1 UTSW 1 150,563,599 (GRCm38) nonsense probably null
R2869:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2869:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2871:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2872:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2873:Hmcn1 UTSW 1 150,738,716 (GRCm38) missense possibly damaging 0.95
R2897:Hmcn1 UTSW 1 150,802,873 (GRCm38) missense probably damaging 1.00
R2905:Hmcn1 UTSW 1 150,749,035 (GRCm38) missense probably damaging 1.00
R3498:Hmcn1 UTSW 1 150,605,102 (GRCm38) missense probably damaging 0.98
R3499:Hmcn1 UTSW 1 150,605,102 (GRCm38) missense probably damaging 0.98
R3724:Hmcn1 UTSW 1 150,689,518 (GRCm38) missense possibly damaging 0.82
R3765:Hmcn1 UTSW 1 150,745,025 (GRCm38) missense possibly damaging 0.72
R3778:Hmcn1 UTSW 1 150,802,824 (GRCm38) missense possibly damaging 0.95
R3790:Hmcn1 UTSW 1 150,622,994 (GRCm38) missense probably benign 0.09
R3796:Hmcn1 UTSW 1 150,586,418 (GRCm38) missense probably damaging 1.00
R3811:Hmcn1 UTSW 1 150,649,577 (GRCm38) critical splice donor site probably null
R3825:Hmcn1 UTSW 1 150,586,965 (GRCm38) missense probably benign 0.28
R3890:Hmcn1 UTSW 1 150,635,195 (GRCm38) missense probably damaging 1.00
R3891:Hmcn1 UTSW 1 150,635,195 (GRCm38) missense probably damaging 1.00
R3892:Hmcn1 UTSW 1 150,635,195 (GRCm38) missense probably damaging 1.00
R3918:Hmcn1 UTSW 1 150,690,610 (GRCm38) missense probably benign 0.00
R3964:Hmcn1 UTSW 1 150,573,569 (GRCm38) missense probably benign 0.00
R4005:Hmcn1 UTSW 1 150,722,453 (GRCm38) missense possibly damaging 0.88
R4026:Hmcn1 UTSW 1 150,722,369 (GRCm38) missense probably benign 0.03
R4037:Hmcn1 UTSW 1 150,772,502 (GRCm38) missense probably benign 0.00
R4088:Hmcn1 UTSW 1 150,703,216 (GRCm38) missense possibly damaging 0.58
R4096:Hmcn1 UTSW 1 150,658,508 (GRCm38) missense probably benign 0.20
R4169:Hmcn1 UTSW 1 150,595,999 (GRCm38) splice site probably null
R4441:Hmcn1 UTSW 1 150,657,459 (GRCm38) missense probably null
R4493:Hmcn1 UTSW 1 150,701,899 (GRCm38) missense probably damaging 1.00
R4501:Hmcn1 UTSW 1 150,633,666 (GRCm38) missense probably damaging 1.00
R4535:Hmcn1 UTSW 1 150,563,780 (GRCm38) missense probably damaging 0.99
R4576:Hmcn1 UTSW 1 150,734,487 (GRCm38) missense probably benign
R4601:Hmcn1 UTSW 1 150,738,645 (GRCm38) missense probably damaging 0.99
R4627:Hmcn1 UTSW 1 150,595,894 (GRCm38) missense probably benign 0.11
R4647:Hmcn1 UTSW 1 150,675,511 (GRCm38) critical splice donor site probably null
R4657:Hmcn1 UTSW 1 150,624,550 (GRCm38) missense probably damaging 1.00
R4717:Hmcn1 UTSW 1 150,619,065 (GRCm38) missense probably benign 0.00
R4721:Hmcn1 UTSW 1 150,772,571 (GRCm38) splice site probably null
R4724:Hmcn1 UTSW 1 150,694,833 (GRCm38) splice site probably null
R4737:Hmcn1 UTSW 1 150,689,595 (GRCm38) missense possibly damaging 0.90
R4744:Hmcn1 UTSW 1 150,577,612 (GRCm38) missense probably damaging 1.00
R4795:Hmcn1 UTSW 1 150,753,611 (GRCm38) missense probably benign 0.00
R4796:Hmcn1 UTSW 1 150,753,611 (GRCm38) missense probably benign 0.00
R4871:Hmcn1 UTSW 1 150,593,085 (GRCm38) missense probably benign 0.02
R4895:Hmcn1 UTSW 1 150,677,379 (GRCm38) missense probably benign 0.00
R4934:Hmcn1 UTSW 1 150,722,535 (GRCm38) missense probably damaging 1.00
R4953:Hmcn1 UTSW 1 150,876,360 (GRCm38) intron probably benign
R4968:Hmcn1 UTSW 1 150,657,470 (GRCm38) missense possibly damaging 0.67
R4974:Hmcn1 UTSW 1 150,819,449 (GRCm38) missense probably benign 0.01
R5024:Hmcn1 UTSW 1 150,680,688 (GRCm38) missense possibly damaging 0.65
R5031:Hmcn1 UTSW 1 150,588,257 (GRCm38) missense probably damaging 1.00
R5093:Hmcn1 UTSW 1 150,737,256 (GRCm38) missense probably benign 0.14
R5096:Hmcn1 UTSW 1 150,610,669 (GRCm38) missense probably damaging 1.00
R5185:Hmcn1 UTSW 1 150,656,741 (GRCm38) missense probably benign 0.03
R5228:Hmcn1 UTSW 1 150,646,701 (GRCm38) missense probably benign 0.00
R5260:Hmcn1 UTSW 1 150,595,861 (GRCm38) missense possibly damaging 0.65
R5264:Hmcn1 UTSW 1 150,679,514 (GRCm38) missense probably benign 0.01
R5282:Hmcn1 UTSW 1 150,582,296 (GRCm38) missense probably damaging 1.00
R5334:Hmcn1 UTSW 1 150,755,372 (GRCm38) missense probably damaging 0.99
R5346:Hmcn1 UTSW 1 150,623,244 (GRCm38) missense probably damaging 1.00
R5423:Hmcn1 UTSW 1 150,701,972 (GRCm38) missense probably damaging 1.00
R5484:Hmcn1 UTSW 1 150,675,540 (GRCm38) missense probably benign 0.00
R5491:Hmcn1 UTSW 1 150,609,825 (GRCm38) splice site probably null
R5531:Hmcn1 UTSW 1 150,743,788 (GRCm38) missense probably damaging 1.00
R5536:Hmcn1 UTSW 1 150,755,291 (GRCm38) missense probably benign 0.01
R5547:Hmcn1 UTSW 1 150,737,506 (GRCm38) missense possibly damaging 0.64
R5580:Hmcn1 UTSW 1 150,577,539 (GRCm38) missense probably benign 0.43
R5626:Hmcn1 UTSW 1 150,656,567 (GRCm38) missense probably damaging 1.00
R5657:Hmcn1 UTSW 1 150,658,562 (GRCm38) missense probably benign 0.02
R5677:Hmcn1 UTSW 1 150,609,778 (GRCm38) missense probably benign 0.00
R5718:Hmcn1 UTSW 1 150,690,600 (GRCm38) nonsense probably null
R5718:Hmcn1 UTSW 1 150,609,666 (GRCm38) missense probably damaging 1.00
R5723:Hmcn1 UTSW 1 150,694,849 (GRCm38) missense possibly damaging 0.95
R5739:Hmcn1 UTSW 1 150,758,474 (GRCm38) splice site probably null
R5739:Hmcn1 UTSW 1 150,808,697 (GRCm38) missense probably benign 0.45
R5751:Hmcn1 UTSW 1 150,573,554 (GRCm38) missense probably damaging 1.00
R5772:Hmcn1 UTSW 1 150,694,878 (GRCm38) missense possibly damaging 0.47
R5804:Hmcn1 UTSW 1 150,674,347 (GRCm38) nonsense probably null
R5809:Hmcn1 UTSW 1 150,649,607 (GRCm38) missense probably damaging 1.00
R5817:Hmcn1 UTSW 1 150,737,524 (GRCm38) missense possibly damaging 0.77
R5824:Hmcn1 UTSW 1 150,993,023 (GRCm38) missense probably benign 0.12
R5881:Hmcn1 UTSW 1 150,630,327 (GRCm38) missense probably damaging 0.99
R5928:Hmcn1 UTSW 1 150,598,897 (GRCm38) missense possibly damaging 0.64
R5929:Hmcn1 UTSW 1 150,577,296 (GRCm38) nonsense probably null
R5940:Hmcn1 UTSW 1 150,657,222 (GRCm38) missense probably benign 0.41
R5973:Hmcn1 UTSW 1 150,563,817 (GRCm38) missense probably damaging 1.00
R5997:Hmcn1 UTSW 1 150,704,173 (GRCm38) missense possibly damaging 0.74
R6027:Hmcn1 UTSW 1 150,802,895 (GRCm38) missense possibly damaging 0.79
R6029:Hmcn1 UTSW 1 150,632,437 (GRCm38) missense probably benign 0.13
R6056:Hmcn1 UTSW 1 150,663,909 (GRCm38) missense probably damaging 1.00
R6065:Hmcn1 UTSW 1 150,770,330 (GRCm38) missense probably benign 0.06
R6083:Hmcn1 UTSW 1 150,755,294 (GRCm38) missense probably damaging 1.00
R6083:Hmcn1 UTSW 1 150,755,293 (GRCm38) missense probably damaging 1.00
R6108:Hmcn1 UTSW 1 150,631,227 (GRCm38) missense possibly damaging 0.95
R6112:Hmcn1 UTSW 1 150,618,936 (GRCm38) missense probably damaging 1.00
R6140:Hmcn1 UTSW 1 150,732,846 (GRCm38) missense probably damaging 1.00
R6144:Hmcn1 UTSW 1 150,722,424 (GRCm38) missense probably damaging 1.00
R6152:Hmcn1 UTSW 1 150,565,425 (GRCm38) missense probably damaging 1.00
R6174:Hmcn1 UTSW 1 150,646,784 (GRCm38) missense probably benign 0.06
R6185:Hmcn1 UTSW 1 150,615,438 (GRCm38) splice site probably null
R6187:Hmcn1 UTSW 1 150,630,728 (GRCm38) missense probably damaging 1.00
R6276:Hmcn1 UTSW 1 150,738,681 (GRCm38) missense possibly damaging 0.69
R6278:Hmcn1 UTSW 1 150,697,419 (GRCm38) critical splice donor site probably null
R6427:Hmcn1 UTSW 1 150,697,476 (GRCm38) missense possibly damaging 0.85
R6431:Hmcn1 UTSW 1 150,744,960 (GRCm38) missense probably benign 0.01
R6441:Hmcn1 UTSW 1 150,703,216 (GRCm38) missense possibly damaging 0.58
R6451:Hmcn1 UTSW 1 150,992,919 (GRCm38) missense probably damaging 1.00
R6478:Hmcn1 UTSW 1 150,664,784 (GRCm38) missense probably damaging 1.00
R6479:Hmcn1 UTSW 1 150,677,302 (GRCm38) nonsense probably null
R6490:Hmcn1 UTSW 1 150,583,278 (GRCm38) missense probably benign 0.00
R6525:Hmcn1 UTSW 1 150,697,566 (GRCm38) missense probably damaging 1.00
R6571:Hmcn1 UTSW 1 150,615,438 (GRCm38) splice site probably null
R6612:Hmcn1 UTSW 1 150,595,118 (GRCm38) critical splice donor site probably null
R6616:Hmcn1 UTSW 1 150,723,257 (GRCm38) critical splice donor site probably null
R6617:Hmcn1 UTSW 1 150,743,796 (GRCm38) missense probably benign 0.01
R6623:Hmcn1 UTSW 1 150,758,306 (GRCm38) missense probably benign
R6687:Hmcn1 UTSW 1 150,745,033 (GRCm38) missense probably benign 0.30
R6714:Hmcn1 UTSW 1 150,704,175 (GRCm38) missense probably damaging 0.97
R6751:Hmcn1 UTSW 1 150,734,518 (GRCm38) missense probably damaging 0.98
R6831:Hmcn1 UTSW 1 150,770,293 (GRCm38) missense probably benign 0.00
R6971:Hmcn1 UTSW 1 150,993,051 (GRCm38) start codon destroyed probably benign 0.00
R7048:Hmcn1 UTSW 1 150,599,653 (GRCm38) critical splice acceptor site probably null
R7058:Hmcn1 UTSW 1 150,773,890 (GRCm38) missense probably benign 0.43
R7071:Hmcn1 UTSW 1 150,604,102 (GRCm38) missense probably damaging 1.00
R7078:Hmcn1 UTSW 1 150,860,367 (GRCm38) missense probably damaging 1.00
R7092:Hmcn1 UTSW 1 150,604,246 (GRCm38) missense probably damaging 1.00
R7120:Hmcn1 UTSW 1 150,700,541 (GRCm38) missense probably damaging 0.98
R7129:Hmcn1 UTSW 1 150,577,210 (GRCm38) splice site probably null
R7144:Hmcn1 UTSW 1 150,663,873 (GRCm38) missense probably damaging 1.00
R7148:Hmcn1 UTSW 1 150,686,854 (GRCm38) missense probably benign 0.00
R7162:Hmcn1 UTSW 1 150,748,993 (GRCm38) missense probably benign 0.18
R7172:Hmcn1 UTSW 1 150,753,699 (GRCm38) missense possibly damaging 0.92
R7193:Hmcn1 UTSW 1 150,649,580 (GRCm38) missense probably null 1.00
R7231:Hmcn1 UTSW 1 150,638,876 (GRCm38) missense probably benign 0.00
R7237:Hmcn1 UTSW 1 150,722,643 (GRCm38) missense probably damaging 0.98
R7258:Hmcn1 UTSW 1 150,715,823 (GRCm38) missense probably benign 0.12
R7286:Hmcn1 UTSW 1 150,582,337 (GRCm38) missense probably damaging 0.98
R7289:Hmcn1 UTSW 1 150,683,715 (GRCm38) missense possibly damaging 0.52
R7292:Hmcn1 UTSW 1 150,733,129 (GRCm38) splice site probably null
R7316:Hmcn1 UTSW 1 150,732,946 (GRCm38) missense probably damaging 1.00
R7327:Hmcn1 UTSW 1 150,603,814 (GRCm38) missense probably benign 0.01
R7328:Hmcn1 UTSW 1 150,638,866 (GRCm38) missense possibly damaging 0.95
R7346:Hmcn1 UTSW 1 150,683,745 (GRCm38) missense probably damaging 1.00
R7351:Hmcn1 UTSW 1 150,667,889 (GRCm38) missense probably damaging 0.98
R7354:Hmcn1 UTSW 1 150,806,445 (GRCm38) nonsense probably null
R7360:Hmcn1 UTSW 1 150,618,846 (GRCm38) missense probably damaging 1.00
R7396:Hmcn1 UTSW 1 150,563,631 (GRCm38) missense possibly damaging 0.83
R7398:Hmcn1 UTSW 1 150,646,670 (GRCm38) missense probably benign 0.00
R7400:Hmcn1 UTSW 1 150,674,430 (GRCm38) missense probably damaging 1.00
R7404:Hmcn1 UTSW 1 150,720,759 (GRCm38) missense probably benign 0.00
R7424:Hmcn1 UTSW 1 150,630,266 (GRCm38) nonsense probably null
R7476:Hmcn1 UTSW 1 150,580,267 (GRCm38) missense probably damaging 0.99
R7480:Hmcn1 UTSW 1 150,677,234 (GRCm38) critical splice donor site probably null
R7516:Hmcn1 UTSW 1 150,622,967 (GRCm38) missense probably benign 0.35
R7526:Hmcn1 UTSW 1 150,656,573 (GRCm38) missense probably damaging 1.00
R7531:Hmcn1 UTSW 1 150,686,780 (GRCm38) missense probably benign 0.06
R7555:Hmcn1 UTSW 1 150,604,874 (GRCm38) missense probably benign 0.40
R7564:Hmcn1 UTSW 1 150,655,835 (GRCm38) missense probably benign
R7588:Hmcn1 UTSW 1 150,657,134 (GRCm38) missense possibly damaging 0.90
R7719:Hmcn1 UTSW 1 150,565,329 (GRCm38) missense possibly damaging 0.95
R7720:Hmcn1 UTSW 1 150,646,709 (GRCm38) missense probably benign 0.00
R7722:Hmcn1 UTSW 1 150,667,880 (GRCm38) missense probably damaging 0.98
R7761:Hmcn1 UTSW 1 150,722,445 (GRCm38) missense possibly damaging 0.70
R7787:Hmcn1 UTSW 1 150,756,592 (GRCm38) missense probably damaging 1.00
R7803:Hmcn1 UTSW 1 150,770,279 (GRCm38) missense probably benign 0.32
R7862:Hmcn1 UTSW 1 150,806,421 (GRCm38) missense probably damaging 0.96
R7876:Hmcn1 UTSW 1 150,744,971 (GRCm38) missense probably benign 0.03
R7886:Hmcn1 UTSW 1 150,657,470 (GRCm38) missense possibly damaging 0.94
R7891:Hmcn1 UTSW 1 150,593,189 (GRCm38) missense probably damaging 1.00
R7892:Hmcn1 UTSW 1 150,664,892 (GRCm38) missense probably benign 0.00
R7927:Hmcn1 UTSW 1 150,609,775 (GRCm38) missense probably damaging 1.00
R7941:Hmcn1 UTSW 1 150,650,084 (GRCm38) missense possibly damaging 0.95
R7960:Hmcn1 UTSW 1 150,655,855 (GRCm38) missense probably damaging 1.00
R8001:Hmcn1 UTSW 1 150,664,878 (GRCm38) nonsense probably null
R8015:Hmcn1 UTSW 1 150,598,311 (GRCm38) missense possibly damaging 0.83
R8070:Hmcn1 UTSW 1 150,649,992 (GRCm38) nonsense probably null
R8072:Hmcn1 UTSW 1 150,656,505 (GRCm38) missense possibly damaging 0.62
R8113:Hmcn1 UTSW 1 150,749,090 (GRCm38) missense possibly damaging 0.50
R8143:Hmcn1 UTSW 1 150,859,206 (GRCm38) missense probably benign 0.03
R8145:Hmcn1 UTSW 1 150,753,660 (GRCm38) missense probably benign 0.33
R8155:Hmcn1 UTSW 1 150,604,954 (GRCm38) missense probably damaging 1.00
R8165:Hmcn1 UTSW 1 150,646,658 (GRCm38) missense probably benign 0.09
R8179:Hmcn1 UTSW 1 150,722,514 (GRCm38) missense probably benign 0.19
R8193:Hmcn1 UTSW 1 150,577,477 (GRCm38) nonsense probably null
R8234:Hmcn1 UTSW 1 150,594,010 (GRCm38) missense possibly damaging 0.83
R8249:Hmcn1 UTSW 1 150,819,366 (GRCm38) missense probably benign 0.24
R8267:Hmcn1 UTSW 1 150,859,254 (GRCm38) missense probably damaging 1.00
R8312:Hmcn1 UTSW 1 150,738,764 (GRCm38) missense probably damaging 0.99
R8338:Hmcn1 UTSW 1 150,738,734 (GRCm38) missense probably benign 0.35
R8354:Hmcn1 UTSW 1 150,758,391 (GRCm38) missense possibly damaging 0.79
R8440:Hmcn1 UTSW 1 150,694,920 (GRCm38) missense probably damaging 1.00
R8473:Hmcn1 UTSW 1 150,603,800 (GRCm38) missense possibly damaging 0.64
R8497:Hmcn1 UTSW 1 150,580,239 (GRCm38) missense probably benign 0.01
R8509:Hmcn1 UTSW 1 150,573,551 (GRCm38) nonsense probably null
R8559:Hmcn1 UTSW 1 150,676,038 (GRCm38) missense probably benign 0.25
R8701:Hmcn1 UTSW 1 150,755,257 (GRCm38) missense probably benign 0.00
R8755:Hmcn1 UTSW 1 150,633,620 (GRCm38) missense probably benign 0.19
R8765:Hmcn1 UTSW 1 150,680,662 (GRCm38) missense probably damaging 0.98
R8782:Hmcn1 UTSW 1 150,664,885 (GRCm38) missense probably benign 0.08
R8794:Hmcn1 UTSW 1 150,715,718 (GRCm38) missense probably benign 0.00
R8803:Hmcn1 UTSW 1 150,734,497 (GRCm38) missense probably damaging 1.00
R8808:Hmcn1 UTSW 1 150,655,819 (GRCm38) missense possibly damaging 0.64
R8853:Hmcn1 UTSW 1 150,671,975 (GRCm38) missense probably damaging 1.00
R8877:Hmcn1 UTSW 1 150,638,908 (GRCm38) missense probably benign 0.00
R8881:Hmcn1 UTSW 1 150,649,972 (GRCm38) missense probably damaging 1.00
R8916:Hmcn1 UTSW 1 150,773,779 (GRCm38) missense probably damaging 1.00
R9008:Hmcn1 UTSW 1 150,755,044 (GRCm38) intron probably benign
R9030:Hmcn1 UTSW 1 150,817,119 (GRCm38) missense probably benign 0.00
R9072:Hmcn1 UTSW 1 150,689,569 (GRCm38) missense probably benign 0.04
R9090:Hmcn1 UTSW 1 150,756,558 (GRCm38) missense probably damaging 1.00
R9096:Hmcn1 UTSW 1 150,657,118 (GRCm38) missense probably benign 0.04
R9102:Hmcn1 UTSW 1 150,697,580 (GRCm38) missense probably benign 0.01
R9146:Hmcn1 UTSW 1 150,598,390 (GRCm38) missense probably benign 0.02
R9157:Hmcn1 UTSW 1 150,646,592 (GRCm38) missense probably benign 0.06
R9169:Hmcn1 UTSW 1 150,630,341 (GRCm38) missense probably damaging 0.99
R9182:Hmcn1 UTSW 1 150,612,654 (GRCm38) missense probably damaging 1.00
R9182:Hmcn1 UTSW 1 150,624,586 (GRCm38) nonsense probably null
R9204:Hmcn1 UTSW 1 150,734,511 (GRCm38) missense probably benign 0.40
R9219:Hmcn1 UTSW 1 150,719,093 (GRCm38) critical splice donor site probably null
R9267:Hmcn1 UTSW 1 150,597,989 (GRCm38) missense probably benign 0.26
R9271:Hmcn1 UTSW 1 150,756,558 (GRCm38) missense probably damaging 1.00
R9274:Hmcn1 UTSW 1 150,630,295 (GRCm38) missense probably benign 0.01
R9313:Hmcn1 UTSW 1 150,646,592 (GRCm38) missense probably benign 0.06
R9414:Hmcn1 UTSW 1 150,669,436 (GRCm38) missense probably damaging 1.00
R9456:Hmcn1 UTSW 1 150,630,302 (GRCm38) nonsense probably null
R9464:Hmcn1 UTSW 1 150,723,497 (GRCm38) missense possibly damaging 0.80
R9474:Hmcn1 UTSW 1 150,630,720 (GRCm38) missense probably damaging 1.00
R9476:Hmcn1 UTSW 1 150,586,376 (GRCm38) missense probably benign 0.00
R9482:Hmcn1 UTSW 1 150,734,530 (GRCm38) missense probably benign 0.06
R9496:Hmcn1 UTSW 1 150,704,220 (GRCm38) missense probably benign 0.00
R9501:Hmcn1 UTSW 1 150,595,239 (GRCm38) missense possibly damaging 0.67
R9510:Hmcn1 UTSW 1 150,586,376 (GRCm38) missense probably benign 0.00
R9529:Hmcn1 UTSW 1 150,669,424 (GRCm38) missense probably damaging 1.00
R9566:Hmcn1 UTSW 1 150,622,909 (GRCm38) missense probably benign 0.00
R9608:Hmcn1 UTSW 1 150,599,552 (GRCm38) missense probably damaging 1.00
R9609:Hmcn1 UTSW 1 150,679,595 (GRCm38) missense probably damaging 0.96
R9616:Hmcn1 UTSW 1 150,808,722 (GRCm38) missense probably benign 0.16
R9627:Hmcn1 UTSW 1 150,630,303 (GRCm38) missense probably damaging 1.00
R9668:Hmcn1 UTSW 1 150,743,741 (GRCm38) missense probably benign 0.02
R9686:Hmcn1 UTSW 1 150,737,605 (GRCm38) missense probably damaging 0.99
R9717:Hmcn1 UTSW 1 150,609,627 (GRCm38) missense probably damaging 1.00
R9727:Hmcn1 UTSW 1 150,798,815 (GRCm38) missense probably benign 0.06
R9744:Hmcn1 UTSW 1 150,748,190 (GRCm38) missense probably damaging 1.00
R9749:Hmcn1 UTSW 1 150,756,588 (GRCm38) missense possibly damaging 0.94
R9761:Hmcn1 UTSW 1 150,992,874 (GRCm38) missense probably damaging 0.98
R9783:Hmcn1 UTSW 1 150,722,629 (GRCm38) missense probably benign 0.16
R9788:Hmcn1 UTSW 1 150,652,582 (GRCm38) missense probably benign 0.00
R9792:Hmcn1 UTSW 1 150,732,938 (GRCm38) missense possibly damaging 0.94
R9793:Hmcn1 UTSW 1 150,732,938 (GRCm38) missense possibly damaging 0.94
R9795:Hmcn1 UTSW 1 150,732,938 (GRCm38) missense possibly damaging 0.94
R9802:Hmcn1 UTSW 1 150,808,640 (GRCm38) missense probably benign 0.07
RF003:Hmcn1 UTSW 1 150,624,561 (GRCm38) missense probably damaging 1.00
RF005:Hmcn1 UTSW 1 150,635,146 (GRCm38) nonsense probably null
X0022:Hmcn1 UTSW 1 150,700,530 (GRCm38) missense probably benign 0.04
X0027:Hmcn1 UTSW 1 150,860,376 (GRCm38) missense probably damaging 1.00
X0028:Hmcn1 UTSW 1 150,663,901 (GRCm38) missense probably damaging 1.00
Z1088:Hmcn1 UTSW 1 150,648,937 (GRCm38) missense probably damaging 1.00
Z1176:Hmcn1 UTSW 1 150,663,917 (GRCm38) missense probably benign 0.12
Z1176:Hmcn1 UTSW 1 150,655,921 (GRCm38) missense possibly damaging 0.65
Z1176:Hmcn1 UTSW 1 150,586,445 (GRCm38) missense probably null 0.92
Predicted Primers PCR Primer
(F):5'- AGCACCATTTTCAAGTTGCC -3'
(R):5'- TCCCATTTGGAATAGCCGCC -3'

Sequencing Primer
(F):5'- GTTGCCAAGATTGCAACTGTTC -3'
(R):5'- GCCAATCAAGATTTAATCCGGCTGG -3'
Posted On 2019-10-07