Incidental Mutation 'R7454:Ralgapb'
ID577966
Institutional Source Beutler Lab
Gene Symbol Ralgapb
Ensembl Gene ENSMUSG00000027652
Gene NameRal GTPase activating protein, beta subunit (non-catalytic)
SynonymsB230339M05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7454 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location158409848-158499253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 158432902 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 241 (I241N)
Ref Sequence ENSEMBL: ENSMUSP00000105111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046274] [ENSMUST00000109485] [ENSMUST00000109486] [ENSMUST00000141497]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046274
AA Change: I241N

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048430
Gene: ENSMUSG00000027652
AA Change: I241N

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
low complexity region 775 788 N/A INTRINSIC
low complexity region 910 920 N/A INTRINSIC
low complexity region 1086 1097 N/A INTRINSIC
low complexity region 1309 1321 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109485
AA Change: I241N

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105111
Gene: ENSMUSG00000027652
AA Change: I241N

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 622 637 N/A INTRINSIC
low complexity region 791 804 N/A INTRINSIC
low complexity region 926 936 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1325 1337 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109486
AA Change: I241N

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105112
Gene: ENSMUSG00000027652
AA Change: I241N

DomainStartEndE-ValueType
low complexity region 166 178 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 914 924 N/A INTRINSIC
low complexity region 1090 1101 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141497
SMART Domains Protein: ENSMUSP00000116481
Gene: ENSMUSG00000027652

DomainStartEndE-ValueType
low complexity region 288 303 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
low complexity region 592 602 N/A INTRINSIC
low complexity region 768 779 N/A INTRINSIC
low complexity region 991 1003 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510002D24Rik A G 16: 18,836,851 E57G possibly damaging Het
4932414N04Rik C A 2: 68,688,304 T159K unknown Het
Adamts10 T A 17: 33,545,005 F616L possibly damaging Het
Adtrp G A 13: 41,828,315 S26L unknown Het
Alpk3 A C 7: 81,078,562 E480A probably benign Het
Anks6 T C 4: 47,038,919 T529A unknown Het
Arl4d A G 11: 101,666,660 H4R probably benign Het
Ash1l A G 3: 88,983,865 H1017R probably benign Het
Bbs12 T C 3: 37,320,953 S517P possibly damaging Het
Bcl11b C A 12: 107,916,208 R616L possibly damaging Het
Bean1 G A 8: 104,211,026 G79D probably damaging Het
Bicra C G 7: 15,972,134 G1461R probably benign Het
Bptf T C 11: 107,044,640 T124A probably benign Het
Btnl4 A T 17: 34,472,374 V312E probably benign Het
Ccdc7a A G 8: 128,944,516 M503T unknown Het
Celf5 T C 10: 81,482,523 E28G probably damaging Het
Cilp2 G A 8: 69,883,390 L350F probably damaging Het
Clec4a2 T C 6: 123,142,452 I245T probably damaging Het
Ctnnal1 A T 4: 56,844,544 V140D probably damaging Het
Dennd4a A C 9: 64,852,570 H319P probably damaging Het
Dlgap3 G T 4: 127,235,059 L857F probably null Het
Dnah6 T A 6: 73,212,492 T58S probably damaging Het
Dnah7a T A 1: 53,518,764 M2164L probably benign Het
Dspp T A 5: 104,175,610 H206Q probably benign Het
Dzip1l G A 9: 99,659,674 V443M possibly damaging Het
Erc2 A G 14: 28,302,991 H939R possibly damaging Het
Fam149a G T 8: 45,348,546 H513N probably benign Het
Fam171a2 T C 11: 102,439,717 T280A possibly damaging Het
Fam208b A G 13: 3,585,332 S492P probably benign Het
Fkbp5 A C 17: 28,416,025 V170G probably damaging Het
Fnbp4 ACCACCTCCACCTCCACCTCC ACCACCTCCACCTCCACCTCCACCTCC 2: 90,777,815 probably benign Het
Fnbp4 ACC ACCCCCCCC 2: 90,777,818 probably benign Het
Fzd2 T C 11: 102,605,129 F133S probably damaging Het
Galm A G 17: 80,138,121 N100S possibly damaging Het
Gbp2b T A 3: 142,598,159 I5N possibly damaging Het
Gga2 T C 7: 122,002,146 R245G probably benign Het
Gm10053 A G 19: 24,875,900 T50A probably benign Het
Gm1110 T C 9: 26,920,649 T69A probably benign Het
Gm15922 T G 7: 3,735,510 E622D probably benign Het
Heatr5a T C 12: 51,961,543 S6G probably benign Het
Hmcn1 A G 1: 150,563,604 S5610P probably damaging Het
Hmgb4 A G 4: 128,260,406 V123A probably damaging Het
Itgal C A 7: 127,327,764 Q943K probably benign Het
Jakmip1 C A 5: 37,175,154 D1059E probably damaging Het
Kat6a A G 8: 22,935,772 E1111G possibly damaging Het
Kdm4b C A 17: 56,389,639 P452T probably benign Het
Krit1 T C 5: 3,812,474 Y210H probably damaging Het
Krtap6-2 A T 16: 89,419,912 Y56N unknown Het
Lig1 A T 7: 13,288,721 D158V probably damaging Het
Lmo1 A T 7: 109,140,666 L94Q probably benign Het
Lrrc30 A T 17: 67,632,243 L114H probably damaging Het
Ltn1 T C 16: 87,397,812 I1400V probably benign Het
Mark3 T C 12: 111,604,527 I87T probably damaging Het
Mfrp G T 9: 44,105,183 V392F possibly damaging Het
Mrgprg A G 7: 143,765,135 L80P probably damaging Het
Ndufaf3 A T 9: 108,566,926 M1K probably null Het
Nme7 T A 1: 164,380,648 L295* probably null Het
Noct G T 3: 51,249,730 C163F probably damaging Het
Olfr1270 T A 2: 90,149,419 I196F possibly damaging Het
Olfr229 A G 9: 39,909,904 I34V probably benign Het
Olfr541 A T 7: 140,704,634 I128F probably damaging Het
Olfr747 T A 14: 50,680,824 Q270L possibly damaging Het
Olfr772 T A 10: 129,174,455 T189S probably damaging Het
Olfr992 T A 2: 85,399,611 K307N probably damaging Het
Per3 A G 4: 151,012,728 L780P probably benign Het
Pla2g4a T C 1: 149,872,690 M256V possibly damaging Het
Pnliprp1 A G 19: 58,741,100 K395R probably benign Het
Poc5 G T 13: 96,400,832 G242V possibly damaging Het
Ppfia4 A G 1: 134,324,135 S434P possibly damaging Het
Prss42 A G 9: 110,798,829 N110S probably benign Het
Rbak A C 5: 143,173,773 Y508* probably null Het
S1pr2 G T 9: 20,967,549 R328S possibly damaging Het
Sap130 T C 18: 31,650,512 M214T probably benign Het
Slc46a1 T A 11: 78,466,511 V130E probably damaging Het
Smc4 A T 3: 69,018,124 H343L probably benign Het
Tarbp1 C A 8: 126,457,677 R500L probably benign Het
Tgfbr3 A T 5: 107,215,028 H39Q probably damaging Het
Tpp2 T C 1: 43,954,659 S235P probably benign Het
Trbc2 G T 6: 41,546,829 R33M Het
Trim3 C T 7: 105,619,558 R63Q probably damaging Het
Ttc28 T C 5: 111,285,484 V2128A probably benign Het
Ttn C T 2: 76,725,818 R30281H probably damaging Het
Ttn T A 2: 76,944,139 Q2187L unknown Het
Ttyh3 T C 5: 140,629,425 S403G possibly damaging Het
Vmn2r112 A T 17: 22,603,307 D322V probably benign Het
Wdr38 C T 2: 38,998,340 probably benign Het
Xrn1 T A 9: 96,048,358 S1543R probably benign Het
Zbtb8b G A 4: 129,432,769 T201I possibly damaging Het
Other mutations in Ralgapb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ralgapb APN 2 158420856 missense probably damaging 1.00
IGL00534:Ralgapb APN 2 158430500 missense possibly damaging 0.72
IGL01362:Ralgapb APN 2 158435465 missense probably damaging 1.00
IGL01653:Ralgapb APN 2 158462159 missense possibly damaging 0.94
IGL01704:Ralgapb APN 2 158420875 missense possibly damaging 0.92
IGL02000:Ralgapb APN 2 158454114 splice site probably benign
IGL02169:Ralgapb APN 2 158426204 missense probably damaging 1.00
IGL02516:Ralgapb APN 2 158465815 splice site probably benign
IGL02548:Ralgapb APN 2 158444665 missense probably damaging 0.97
IGL02550:Ralgapb APN 2 158448411 missense probably damaging 1.00
IGL02653:Ralgapb APN 2 158443309 missense probably damaging 1.00
IGL02744:Ralgapb APN 2 158446151 missense probably damaging 1.00
IGL02804:Ralgapb APN 2 158426284 missense possibly damaging 0.78
IGL02937:Ralgapb APN 2 158493016 splice site probably null
IGL02993:Ralgapb APN 2 158437394 missense possibly damaging 0.90
IGL03154:Ralgapb APN 2 158432866 missense probably damaging 1.00
IGL03204:Ralgapb APN 2 158465912 missense possibly damaging 0.67
IGL03347:Ralgapb APN 2 158465960 missense possibly damaging 0.67
PIT4142001:Ralgapb UTSW 2 158430422 missense probably benign 0.34
R0037:Ralgapb UTSW 2 158437411 missense probably damaging 1.00
R0037:Ralgapb UTSW 2 158437411 missense probably damaging 1.00
R0077:Ralgapb UTSW 2 158473249 missense probably damaging 1.00
R0581:Ralgapb UTSW 2 158492961 missense probably benign
R0629:Ralgapb UTSW 2 158439547 missense probably damaging 1.00
R0839:Ralgapb UTSW 2 158473283 critical splice donor site probably null
R1331:Ralgapb UTSW 2 158430533 missense probably damaging 1.00
R1468:Ralgapb UTSW 2 158462253 missense possibly damaging 0.95
R1468:Ralgapb UTSW 2 158462253 missense possibly damaging 0.95
R1540:Ralgapb UTSW 2 158465826 missense probably benign 0.00
R1572:Ralgapb UTSW 2 158446199 splice site probably benign
R1628:Ralgapb UTSW 2 158430463 missense probably benign 0.04
R1718:Ralgapb UTSW 2 158443280 nonsense probably null
R1777:Ralgapb UTSW 2 158462195 missense probably damaging 1.00
R1822:Ralgapb UTSW 2 158492452 missense probably damaging 0.99
R1903:Ralgapb UTSW 2 158495563 missense probably benign 0.04
R1909:Ralgapb UTSW 2 158444675 missense probably damaging 1.00
R2157:Ralgapb UTSW 2 158437472 missense probably benign 0.15
R4524:Ralgapb UTSW 2 158437306 missense probably benign 0.00
R4946:Ralgapb UTSW 2 158440967 missense probably damaging 1.00
R4975:Ralgapb UTSW 2 158435508 missense possibly damaging 0.66
R5014:Ralgapb UTSW 2 158495535 missense probably damaging 1.00
R5165:Ralgapb UTSW 2 158465912 missense possibly damaging 0.67
R5465:Ralgapb UTSW 2 158448405 missense possibly damaging 0.81
R5526:Ralgapb UTSW 2 158432785 missense probably damaging 1.00
R5566:Ralgapb UTSW 2 158494710 missense possibly damaging 0.90
R5949:Ralgapb UTSW 2 158454259 missense probably damaging 1.00
R6140:Ralgapb UTSW 2 158456572 missense probably damaging 1.00
R6175:Ralgapb UTSW 2 158446155 missense probably damaging 1.00
R6192:Ralgapb UTSW 2 158449447 intron probably null
R6364:Ralgapb UTSW 2 158462109 missense probably damaging 1.00
R6458:Ralgapb UTSW 2 158444620 missense probably damaging 1.00
R6746:Ralgapb UTSW 2 158476136 missense probably damaging 1.00
R6782:Ralgapb UTSW 2 158436566 missense probably damaging 0.99
R6788:Ralgapb UTSW 2 158436566 missense probably damaging 0.99
R7017:Ralgapb UTSW 2 158448337 missense probably benign 0.19
R7108:Ralgapb UTSW 2 158492460 missense probably damaging 0.98
R7108:Ralgapb UTSW 2 158494662 missense probably damaging 1.00
R7236:Ralgapb UTSW 2 158440827 missense probably benign 0.34
R7485:Ralgapb UTSW 2 158443355 missense probably benign 0.35
R7595:Ralgapb UTSW 2 158426165 missense possibly damaging 0.91
R7615:Ralgapb UTSW 2 158450270 missense probably damaging 0.99
R7728:Ralgapb UTSW 2 158482503 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGCATTGCTGAGAATCTAGC -3'
(R):5'- ACACAGTTCTTTAGCCATCGTTAC -3'

Sequencing Primer
(F):5'- CATTGCTGAGAATCTAGCAGAGAAGC -3'
(R):5'- TAGAGGTTGGAGGATAACTCTCC -3'
Posted On2019-10-07