Incidental Mutation 'R7454:Per3'
ID577977
Institutional Source Beutler Lab
Gene Symbol Per3
Ensembl Gene ENSMUSG00000028957
Gene Nameperiod circadian clock 3
SynonymsmPer3, 2810049O06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R7454 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location151003652-151044665 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151012728 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 780 (L780P)
Ref Sequence ENSEMBL: ENSMUSP00000099493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103204] [ENSMUST00000136398] [ENSMUST00000169423]
PDB Structure
Unwinding the Differences of the Mammalian PERIOD Clock Proteins from Crystal Structure to Cellular Function [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000103204
AA Change: L780P

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099493
Gene: ENSMUSG00000028957
AA Change: L780P

DomainStartEndE-ValueType
PAS 115 187 2.86e1 SMART
PAS 258 324 1.31e-5 SMART
PAC 333 376 1.52e-1 SMART
low complexity region 414 427 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 799 814 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
Pfam:Period_C 905 1111 4.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136398
SMART Domains Protein: ENSMUSP00000118950
Gene: ENSMUSG00000028957

DomainStartEndE-ValueType
PAS 115 187 2.86e1 SMART
PAS 258 324 1.31e-5 SMART
PAC 333 376 3.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169423
SMART Domains Protein: ENSMUSP00000127916
Gene: ENSMUSG00000014592

DomainStartEndE-ValueType
CG-1 67 183 1.39e-91 SMART
low complexity region 550 583 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
Pfam:TIG 874 954 3.1e-11 PFAM
low complexity region 997 1030 N/A INTRINSIC
ANK 1066 1095 1.7e2 SMART
ANK 1111 1141 4.73e2 SMART
low complexity region 1301 1319 N/A INTRINSIC
IQ 1548 1564 2.38e2 SMART
IQ 1578 1600 5.42e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been linked to sleep disorders. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit a shorter circadian cycle length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510002D24Rik A G 16: 18,836,851 E57G possibly damaging Het
4932414N04Rik C A 2: 68,688,304 T159K unknown Het
Adamts10 T A 17: 33,545,005 F616L possibly damaging Het
Adtrp G A 13: 41,828,315 S26L unknown Het
Alpk3 A C 7: 81,078,562 E480A probably benign Het
Anks6 T C 4: 47,038,919 T529A unknown Het
Arl4d A G 11: 101,666,660 H4R probably benign Het
Ash1l A G 3: 88,983,865 H1017R probably benign Het
Bbs12 T C 3: 37,320,953 S517P possibly damaging Het
Bcl11b C A 12: 107,916,208 R616L possibly damaging Het
Bean1 G A 8: 104,211,026 G79D probably damaging Het
Bicra C G 7: 15,972,134 G1461R probably benign Het
Bptf T C 11: 107,044,640 T124A probably benign Het
Btnl4 A T 17: 34,472,374 V312E probably benign Het
Ccdc7a A G 8: 128,944,516 M503T unknown Het
Celf5 T C 10: 81,482,523 E28G probably damaging Het
Cilp2 G A 8: 69,883,390 L350F probably damaging Het
Clec4a2 T C 6: 123,142,452 I245T probably damaging Het
Ctnnal1 A T 4: 56,844,544 V140D probably damaging Het
Dennd4a A C 9: 64,852,570 H319P probably damaging Het
Dlgap3 G T 4: 127,235,059 L857F probably null Het
Dnah6 T A 6: 73,212,492 T58S probably damaging Het
Dnah7a T A 1: 53,518,764 M2164L probably benign Het
Dspp T A 5: 104,175,610 H206Q probably benign Het
Dzip1l G A 9: 99,659,674 V443M possibly damaging Het
Erc2 A G 14: 28,302,991 H939R possibly damaging Het
Fam149a G T 8: 45,348,546 H513N probably benign Het
Fam171a2 T C 11: 102,439,717 T280A possibly damaging Het
Fam208b A G 13: 3,585,332 S492P probably benign Het
Fkbp5 A C 17: 28,416,025 V170G probably damaging Het
Fnbp4 ACCACCTCCACCTCCACCTCC ACCACCTCCACCTCCACCTCCACCTCC 2: 90,777,815 probably benign Het
Fzd2 T C 11: 102,605,129 F133S probably damaging Het
Galm A G 17: 80,138,121 N100S possibly damaging Het
Gbp2b T A 3: 142,598,159 I5N possibly damaging Het
Gga2 T C 7: 122,002,146 R245G probably benign Het
Gm10053 A G 19: 24,875,900 T50A probably benign Het
Gm1110 T C 9: 26,920,649 T69A probably benign Het
Gm15922 T G 7: 3,735,510 E622D probably benign Het
Heatr5a T C 12: 51,961,543 S6G probably benign Het
Hmcn1 A G 1: 150,563,604 S5610P probably damaging Het
Hmgb4 A G 4: 128,260,406 V123A probably damaging Het
Itgal C A 7: 127,327,764 Q943K probably benign Het
Jakmip1 C A 5: 37,175,154 D1059E probably damaging Het
Jazf1 T C 6: 52,893,944 probably null Het
Kat6a A G 8: 22,935,772 E1111G possibly damaging Het
Kdm4b C A 17: 56,389,639 P452T probably benign Het
Krit1 T C 5: 3,812,474 Y210H probably damaging Het
Krtap6-2 A T 16: 89,419,912 Y56N unknown Het
Lig1 A T 7: 13,288,721 D158V probably damaging Het
Lmo1 A T 7: 109,140,666 L94Q probably benign Het
Lrrc30 A T 17: 67,632,243 L114H probably damaging Het
Ltn1 T C 16: 87,397,812 I1400V probably benign Het
Mark3 T C 12: 111,604,527 I87T probably damaging Het
Mfrp G T 9: 44,105,183 V392F possibly damaging Het
Mrgprg A G 7: 143,765,135 L80P probably damaging Het
Ndufaf3 A T 9: 108,566,926 M1K probably null Het
Nme7 T A 1: 164,380,648 L295* probably null Het
Noct G T 3: 51,249,730 C163F probably damaging Het
Olfr1270 T A 2: 90,149,419 I196F possibly damaging Het
Olfr229 A G 9: 39,909,904 I34V probably benign Het
Olfr541 A T 7: 140,704,634 I128F probably damaging Het
Olfr747 T A 14: 50,680,824 Q270L possibly damaging Het
Olfr772 T A 10: 129,174,455 T189S probably damaging Het
Olfr992 T A 2: 85,399,611 K307N probably damaging Het
Patz1 C T 11: 3,298,297 probably benign Het
Pla2g4a T C 1: 149,872,690 M256V possibly damaging Het
Pnliprp1 A G 19: 58,741,100 K395R probably benign Het
Poc5 G T 13: 96,400,832 G242V possibly damaging Het
Ppfia4 A G 1: 134,324,135 S434P possibly damaging Het
Prss42 A G 9: 110,798,829 N110S probably benign Het
Ralgapb T A 2: 158,432,902 I241N possibly damaging Het
Rbak A C 5: 143,173,773 Y508* probably null Het
S1pr2 G T 9: 20,967,549 R328S possibly damaging Het
Sap130 T C 18: 31,650,512 M214T probably benign Het
Slc46a1 T A 11: 78,466,511 V130E probably damaging Het
Smc4 A T 3: 69,018,124 H343L probably benign Het
Tarbp1 C A 8: 126,457,677 R500L probably benign Het
Tgfbr3 A T 5: 107,215,028 H39Q probably damaging Het
Tpp2 T C 1: 43,954,659 S235P probably benign Het
Trbc2 G T 6: 41,546,829 R33M Het
Trim3 C T 7: 105,619,558 R63Q probably damaging Het
Ttc28 T C 5: 111,285,484 V2128A probably benign Het
Ttn C T 2: 76,725,818 R30281H probably damaging Het
Ttn T A 2: 76,944,139 Q2187L unknown Het
Ttyh3 T C 5: 140,629,425 S403G possibly damaging Het
Vmn2r112 A T 17: 22,603,307 D322V probably benign Het
Wdr38 C T 2: 38,998,340 probably benign Het
Xrn1 T A 9: 96,048,358 S1543R probably benign Het
Zbtb8b G A 4: 129,432,769 T201I possibly damaging Het
Other mutations in Per3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Per3 APN 4 151013598 missense probably benign 0.28
IGL02112:Per3 APN 4 151029183 missense probably benign 0.20
IGL02428:Per3 APN 4 151018217 critical splice donor site probably null
IGL02812:Per3 APN 4 151024470 missense probably damaging 0.99
IGL03094:Per3 APN 4 151009298 missense probably damaging 1.00
R0119:Per3 UTSW 4 151024548 intron probably benign
R0565:Per3 UTSW 4 151033952 missense probably damaging 1.00
R0671:Per3 UTSW 4 151028831 missense probably benign 0.27
R1186:Per3 UTSW 4 151026138 missense probably damaging 0.99
R1736:Per3 UTSW 4 151009248 critical splice donor site probably null
R1757:Per3 UTSW 4 151042792 critical splice acceptor site probably null
R1900:Per3 UTSW 4 151041426 missense probably damaging 1.00
R1929:Per3 UTSW 4 151018885 missense probably damaging 1.00
R2044:Per3 UTSW 4 151033938 missense probably benign 0.01
R2272:Per3 UTSW 4 151018885 missense probably damaging 1.00
R2415:Per3 UTSW 4 151012690 missense possibly damaging 0.91
R4771:Per3 UTSW 4 151009259 missense probably damaging 1.00
R5199:Per3 UTSW 4 151012895 missense probably benign 0.15
R5298:Per3 UTSW 4 151029209 missense probably damaging 1.00
R5330:Per3 UTSW 4 151041302 missense probably damaging 1.00
R5331:Per3 UTSW 4 151041302 missense probably damaging 1.00
R5920:Per3 UTSW 4 151012450 missense probably benign 0.05
R5974:Per3 UTSW 4 151042737 missense possibly damaging 0.83
R6498:Per3 UTSW 4 151029205 missense probably benign 0.27
R6907:Per3 UTSW 4 151043558 critical splice donor site probably null
R6915:Per3 UTSW 4 151043649 missense possibly damaging 0.84
R7269:Per3 UTSW 4 151031936 nonsense probably null
R7555:Per3 UTSW 4 151018058 nonsense probably null
R7771:Per3 UTSW 4 151026200 missense probably damaging 1.00
R7771:Per3 UTSW 4 151041445 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATGGTCATCAAAGTATCCACG -3'
(R):5'- CCTTGGTTATCATCAGCAGGG -3'

Sequencing Primer
(F):5'- TGGTCATCAAAGTATCCACGTAAGC -3'
(R):5'- GTTATCATCAGCAGGGTCCACTG -3'
Posted On2019-10-07