Incidental Mutation 'R7454:Tgfbr3'
ID577981
Institutional Source Beutler Lab
Gene Symbol Tgfbr3
Ensembl Gene ENSMUSG00000029287
Gene Nametransforming growth factor, beta receptor III
Synonymsbetaglycan, TBRIII, 1110036H20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7454 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location107106570-107289629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107215028 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 39 (H39Q)
Ref Sequence ENSEMBL: ENSMUSP00000031224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031224]
Predicted Effect probably damaging
Transcript: ENSMUST00000031224
AA Change: H39Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031224
Gene: ENSMUSG00000029287
AA Change: H39Q

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
internal_repeat_1 64 193 2.48e-5 PROSPERO
internal_repeat_1 232 361 2.48e-5 PROSPERO
low complexity region 419 430 N/A INTRINSIC
ZP 454 731 8.12e-65 SMART
transmembrane domain 786 808 N/A INTRINSIC
low complexity region 835 849 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146591
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (90/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes the transforming growth factor (TGF)-beta type III receptor. The encoded receptor is a membrane proteoglycan that often functions as a co-receptor with other TGF-beta receptor superfamily members. Ectodomain shedding produces soluble TGFBR3, which may inhibit TGFB signaling. Decreased expression of this receptor has been observed in various cancers. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die as embryos. The very few individuals that survive are poorly fertile with abnormalities of the spleen, liver, heart, and skeletal system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510002D24Rik A G 16: 18,836,851 E57G possibly damaging Het
4932414N04Rik C A 2: 68,688,304 T159K unknown Het
Adamts10 T A 17: 33,545,005 F616L possibly damaging Het
Adtrp G A 13: 41,828,315 S26L unknown Het
Alpk3 A C 7: 81,078,562 E480A probably benign Het
Anks6 T C 4: 47,038,919 T529A unknown Het
Arl4d A G 11: 101,666,660 H4R probably benign Het
Ash1l A G 3: 88,983,865 H1017R probably benign Het
Bbs12 T C 3: 37,320,953 S517P possibly damaging Het
Bcl11b C A 12: 107,916,208 R616L possibly damaging Het
Bean1 G A 8: 104,211,026 G79D probably damaging Het
Bicra C G 7: 15,972,134 G1461R probably benign Het
Bptf T C 11: 107,044,640 T124A probably benign Het
Btnl4 A T 17: 34,472,374 V312E probably benign Het
Ccdc7a A G 8: 128,944,516 M503T unknown Het
Celf5 T C 10: 81,482,523 E28G probably damaging Het
Cilp2 G A 8: 69,883,390 L350F probably damaging Het
Clec4a2 T C 6: 123,142,452 I245T probably damaging Het
Ctnnal1 A T 4: 56,844,544 V140D probably damaging Het
Dennd4a A C 9: 64,852,570 H319P probably damaging Het
Dlgap3 G T 4: 127,235,059 L857F probably null Het
Dnah6 T A 6: 73,212,492 T58S probably damaging Het
Dnah7a T A 1: 53,518,764 M2164L probably benign Het
Dspp T A 5: 104,175,610 H206Q probably benign Het
Dzip1l G A 9: 99,659,674 V443M possibly damaging Het
Erc2 A G 14: 28,302,991 H939R possibly damaging Het
Fam149a G T 8: 45,348,546 H513N probably benign Het
Fam171a2 T C 11: 102,439,717 T280A possibly damaging Het
Fam208b A G 13: 3,585,332 S492P probably benign Het
Fkbp5 A C 17: 28,416,025 V170G probably damaging Het
Fnbp4 ACCACCTCCACCTCCACCTCC ACCACCTCCACCTCCACCTCCACCTCC 2: 90,777,815 probably benign Het
Fzd2 T C 11: 102,605,129 F133S probably damaging Het
Galm A G 17: 80,138,121 N100S possibly damaging Het
Gbp2b T A 3: 142,598,159 I5N possibly damaging Het
Gga2 T C 7: 122,002,146 R245G probably benign Het
Gm10053 A G 19: 24,875,900 T50A probably benign Het
Gm1110 T C 9: 26,920,649 T69A probably benign Het
Gm15922 T G 7: 3,735,510 E622D probably benign Het
Heatr5a T C 12: 51,961,543 S6G probably benign Het
Hmcn1 A G 1: 150,563,604 S5610P probably damaging Het
Hmgb4 A G 4: 128,260,406 V123A probably damaging Het
Itgal C A 7: 127,327,764 Q943K probably benign Het
Jakmip1 C A 5: 37,175,154 D1059E probably damaging Het
Jazf1 T C 6: 52,893,944 probably null Het
Kat6a A G 8: 22,935,772 E1111G possibly damaging Het
Kdm4b C A 17: 56,389,639 P452T probably benign Het
Krit1 T C 5: 3,812,474 Y210H probably damaging Het
Krtap6-2 A T 16: 89,419,912 Y56N unknown Het
Lig1 A T 7: 13,288,721 D158V probably damaging Het
Lmo1 A T 7: 109,140,666 L94Q probably benign Het
Lrrc30 A T 17: 67,632,243 L114H probably damaging Het
Ltn1 T C 16: 87,397,812 I1400V probably benign Het
Mark3 T C 12: 111,604,527 I87T probably damaging Het
Mfrp G T 9: 44,105,183 V392F possibly damaging Het
Mrgprg A G 7: 143,765,135 L80P probably damaging Het
Ndufaf3 A T 9: 108,566,926 M1K probably null Het
Nme7 T A 1: 164,380,648 L295* probably null Het
Noct G T 3: 51,249,730 C163F probably damaging Het
Olfr1270 T A 2: 90,149,419 I196F possibly damaging Het
Olfr229 A G 9: 39,909,904 I34V probably benign Het
Olfr541 A T 7: 140,704,634 I128F probably damaging Het
Olfr747 T A 14: 50,680,824 Q270L possibly damaging Het
Olfr772 T A 10: 129,174,455 T189S probably damaging Het
Olfr992 T A 2: 85,399,611 K307N probably damaging Het
Patz1 C T 11: 3,298,297 probably benign Het
Per3 A G 4: 151,012,728 L780P probably benign Het
Pla2g4a T C 1: 149,872,690 M256V possibly damaging Het
Pnliprp1 A G 19: 58,741,100 K395R probably benign Het
Poc5 G T 13: 96,400,832 G242V possibly damaging Het
Ppfia4 A G 1: 134,324,135 S434P possibly damaging Het
Prss42 A G 9: 110,798,829 N110S probably benign Het
Ralgapb T A 2: 158,432,902 I241N possibly damaging Het
Rbak A C 5: 143,173,773 Y508* probably null Het
S1pr2 G T 9: 20,967,549 R328S possibly damaging Het
Sap130 T C 18: 31,650,512 M214T probably benign Het
Slc46a1 T A 11: 78,466,511 V130E probably damaging Het
Smc4 A T 3: 69,018,124 H343L probably benign Het
Tarbp1 C A 8: 126,457,677 R500L probably benign Het
Tpp2 T C 1: 43,954,659 S235P probably benign Het
Trbc2 G T 6: 41,546,829 R33M Het
Trim3 C T 7: 105,619,558 R63Q probably damaging Het
Ttc28 T C 5: 111,285,484 V2128A probably benign Het
Ttn C T 2: 76,725,818 R30281H probably damaging Het
Ttn T A 2: 76,944,139 Q2187L unknown Het
Ttyh3 T C 5: 140,629,425 S403G possibly damaging Het
Vmn2r112 A T 17: 22,603,307 D322V probably benign Het
Wdr38 C T 2: 38,998,340 probably benign Het
Xrn1 T A 9: 96,048,358 S1543R probably benign Het
Zbtb8b G A 4: 129,432,769 T201I possibly damaging Het
Other mutations in Tgfbr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Tgfbr3 APN 5 107142501 missense probably benign 0.00
IGL01135:Tgfbr3 APN 5 107215028 missense probably damaging 1.00
IGL01375:Tgfbr3 APN 5 107136971 missense probably benign
IGL01457:Tgfbr3 APN 5 107149898 missense probably damaging 1.00
IGL01599:Tgfbr3 APN 5 107118451 missense probably damaging 0.98
IGL01646:Tgfbr3 APN 5 107121413 splice site probably benign
IGL01945:Tgfbr3 APN 5 107121358 critical splice donor site probably null
IGL03039:Tgfbr3 APN 5 107177799 splice site probably benign
IGL03202:Tgfbr3 APN 5 107109764 splice site probably benign
IGL03378:Tgfbr3 APN 5 107109702 missense probably damaging 1.00
R0131:Tgfbr3 UTSW 5 107132816 missense probably benign 0.00
R0452:Tgfbr3 UTSW 5 107140423 missense probably benign 0.00
R0665:Tgfbr3 UTSW 5 107177850 missense probably benign 0.11
R0667:Tgfbr3 UTSW 5 107177850 missense probably benign 0.11
R0751:Tgfbr3 UTSW 5 107139883 missense probably damaging 1.00
R1373:Tgfbr3 UTSW 5 107214943 missense probably benign 0.01
R1777:Tgfbr3 UTSW 5 107136930 missense probably benign 0.31
R1887:Tgfbr3 UTSW 5 107137008 missense probably damaging 1.00
R3019:Tgfbr3 UTSW 5 107137546 missense possibly damaging 0.70
R3552:Tgfbr3 UTSW 5 107139839 missense probably damaging 0.99
R3617:Tgfbr3 UTSW 5 107140619 missense possibly damaging 0.65
R3901:Tgfbr3 UTSW 5 107214887 splice site probably benign
R4830:Tgfbr3 UTSW 5 107109719 missense probably damaging 1.00
R4939:Tgfbr3 UTSW 5 107130469 missense probably benign
R5020:Tgfbr3 UTSW 5 107214970 missense probably damaging 1.00
R5044:Tgfbr3 UTSW 5 107136929 missense possibly damaging 0.88
R5619:Tgfbr3 UTSW 5 107140514 missense probably benign 0.23
R5752:Tgfbr3 UTSW 5 107139807 missense probably benign 0.01
R5768:Tgfbr3 UTSW 5 107149895 missense probably benign
R5799:Tgfbr3 UTSW 5 107109608 utr 3 prime probably benign
R5818:Tgfbr3 UTSW 5 107133003 missense probably benign
R5846:Tgfbr3 UTSW 5 107140655 missense possibly damaging 0.51
R5859:Tgfbr3 UTSW 5 107140515 missense probably benign 0.00
R6049:Tgfbr3 UTSW 5 107118485 missense probably damaging 0.99
R6378:Tgfbr3 UTSW 5 107177813 missense probably benign 0.00
R6696:Tgfbr3 UTSW 5 107136930 missense probably benign 0.02
R6823:Tgfbr3 UTSW 5 107149914 missense probably damaging 1.00
R6994:Tgfbr3 UTSW 5 107133026 missense probably damaging 1.00
R7773:Tgfbr3 UTSW 5 107140502 missense probably benign 0.00
X0022:Tgfbr3 UTSW 5 107136926 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTAAGACACAGCAAGGCAG -3'
(R):5'- TGGGATTTCAGATGATGAGACCAG -3'

Sequencing Primer
(F):5'- GTGCTTTCTACACAAGGCTGACAG -3'
(R):5'- CAGATGATGAGACCAGCTTTTTAATC -3'
Posted On2019-10-07